S03036-02_B04
Seqid S03036-02_B04
Sequence >S03036-02_B04.phd
NNNNNTNTTTGGGCCCNNNNNNNNANGGNGATTGNCGGCCAATCGGCCGAATTGGTAGTT
ATCCAAGACAAAAAACCAGCAGCTAACATTGCTACACATAACTAAAGAACAACACCAAGC
CAGTAACTAGCACGAAAGGAAGGAAAGTAAAGTTTTGTATCCCATTCTCTTTTTTGATTC
TTATTGAAATGTTAGGATTATATCTATCCTCCCTTTTCTTCGCCTTTTTTATGGCACAAG
TGTTTGCTACCAAATACTCAATTACTTTTACATCAGATGAGTATGAAGAAGATGAAACAG
GACAAAATGAACCTGGTCCTTTAGTTTTCCATTTGGATAAAAACTCATTACCACCAGCTC
TGCTAAATCAAATGGAGTTTAATCCATACTTAGTATTAGCAGATTTACCGGAGGAGCCGC
GAGCTGTTGATTCTCAAAAACAAACCAANACGGTGANGCGGCNAAAATTGTTNTAGAGTG
GNGAGGGAGNNTACAATAAGAGNTNGTATTCAAAAAANANATCTAAAATTGAAAGGGAAG
GGACGACAAANGATGGAGAGAGGGNAGGAAGAAGAAAAAGAAGAGTAATNGNCTNTAAGN
NGGGAGGNNGNANAGNAGGAAATNTTATNATTGTGTAAAANNTNNTAAGAAAAAAGACGA
AANGGNNCCGNAAAGGNCTCNNNCAGNGGAAGAANAGGGATAGACANATTGGCCGNGTGN
AAATAATCNGAAATCANNANANAGGAGTGAGAATGGANCTTGNTCCATACTAAACAGGTA
NTNGGGGAAATANGGTTTTGNNNNGGTTATGTTAGGNTATAAAAAACGGAACAGACCAGN
TATANCNAGANATTCAGGGCGANNAANAAAATAGGTTNAGAATAATANTTTTACAAGN
Quality >S03036-02_B04.phd
5 3 5 6 7 10 6 13 8 11 8 21 15 8 14 8 7
5 7 5 5 5 5 5 11 5 12 8 5 14 13 17 26 18
6 11 15 17 15 10 8 10 28 30 30 28 26 30 30 33 16
30 28 26 12 24 17 29 35 27 27 28 35 32 35 28 35 44
25 60 52 52 52 43 30 32 31 20 35 42 29 35 46 52 42
52 42 32 47 57 60 47 39 39 53 18 53 27 42 35 39 45
45 32 32 19 31 35 35 47 33 35 53 39 42 53 53 53 57
53 52 52 60 52 60 53 52 52 52 57 52 60 52 57 52 60
60 52 60 52 57 57 63 63 58 63 63 60 60 60 57 58 58
60 60 57 58 60 60 57 57 57 52 52 57 58 57 52 57 60
60 60 57 60 57 53 57 52 58 60 58 63 63 58 60 63 58
58 58 63 63 63 53 63 63 63 58 52 53 60 57 57 52 57
52 53 60 60 60 57 57 60 57 60 60 60 58 63 53 58 58
52 52 57 60 60 57 60 60 45 35 35 48 52 28 29 35 20
30 53 52 60 60 60 48 63 53 52 60 52 52 52 60 60 57
57 58 60 63 52 60 63 63 63 63 60 60 60 52 60 60 57
57 52 52 60 53 52 58 63 57 57 52 52 57 57 60 57 57
57 52 58 46 57 57 57 57 57 60 52 63 52 53 57 52 60
48 52 57 60 52 48 57 57 57 57 52 53 47 45 53 34 32
44 52 60 57 35 47 45 45 53 60 53 43 29 18 45 57 53
53 45 53 53 47 35 42 45 53 35 31 31 34 47 23 28 41
31 32 39 44 37 53 39 27 37 40 53 46 33 60 57 60 53
53 57 53 57 53 47 42 42 53 45 40 40 40 53 53 42 30
38 53 46 46 35 18 12 10 9 8 9 30 41 35 24 28 27
23 29 17 19 11 12 14 12 42 37 29 27 21 11 18 19 19
23 14 12 23 34 24 22 30 32 12 15 19 9 28 33 14 16
19 13 9 10 10 25 6 9 16 11 16 8 11 11 7 23 14
10 11 9 6 9 11 11 8 11 10 23 24 11 6 9 11 11
11 11 13 19 9 6 12 9 14 14 9 10 9 6 6 9 11
13 16 10 12 28 11 11 10 9 6 9 7 15 11 22 11 12
10 25 17 17 20 23 23 6 12 7 11 11 11 13 14 17 16
9 11 14 32 25 16 12 12 10 11 11 11 11 11 16 13 18
13 8 11 12 13 11 7 9 11 10 9 9 10 9 12 34 16
12 8 10 7 11 10 11 10 15 16 15 14 9 11 11 11 14
24 10 9 13 18 11 13 16 9 10 11 6 9 7 18 10 6
11 11 9 11 7 6 11 12 10 10 10 18 6 6 14 6 11
6 10 19 7 9 21 10 10 11 16 19 7 8 10 15 13 7
9 10 10 14 11 10 13 13 17 14 22 6 7 9 6 7 11
13 11 11 11 19 16 20 42 23 9 14 10 14 14 10 11 6
17 11 6 6 10 10 11 7 16 12 10 9 10 7 8 10 9
7 6 7 9 14 10 6 9 10 10 9 8 9 9 7 19 9
10 11 10 14 11 13 12 9 13 6 11 9 10 9 8 11 10
10 6 9 9 9 7 11 9 9 9 11 12 17 9 6 10 10
15 10 9 9 9 7 6 9 6 9 6 10 8 13 9 14 10
9 11 18 12 13 15 11 8 11 6 10 14 10 10 6 14 10
10 12 8 10 10 9 10 17 16 10 26 11 9 10 13 6 11
6 9 10 10 9 11 14 25 13 9 7 9 10 9 13 9 9
10 7 6 6 6 11 9 9 12 11 11 9 9 9 14 9 8
6 11 11 12 12 21 15 18 11 12 10 13 9 14 11 9 9
10 9 11 10 9 9 6 9 11 8 9 6 9 6 9 8 10
6 11 13 10 11 10 12 15 9 9 9 11 6 6 9 9 6
10 8 8 9 8 9 9 12 11 8 7 10 9 20 9 9 12
13 14 14 7 13 11 13 16 11 9 23 18 10 6