S03036-02_B06
Seqid S03036-02_B06
Sequence >S03036-02_B06.phd
CCNNNNTNTTTGGNGNATNNNANNGCCNNATCGGCCGAATTGACAAGCAAACCGGCTTGG
GTCTAACTCAAGGCTGGTCTAACACAAACAACTTGAAGACCAAATTAGAGTTTGCCAACT
TGACCCCTGGTCTAAAGAACGAATTGATCACTTCTTTGACTCCAGGCGTCGCCAAGTCCG
CCGTCTTAAACACTACGTTCACACAACCTTTCTTCACCGCAAGAGGTGCCTTTGACTTGT
GTTTGAAGTCACCAACATTTGTTGGTGACTTAACTATGGCCCAGGAANGNANTGTGGGGG
GCTCATANATAGGTCGCAACGAGAGAGCTGCAGAAGTANATAAAAGATAAGGNGCTNNAT
AATTTCANATGNGAGACGTAAAAAATGGGAAGTGCGTAGCTTAGGGCCAAAGGNNAAGAG
ACNGAAAANCNNATAGGAGGTAATNTGTANACCTTNAGAAACGAAGGGAAGCGGGGAGAN
TTTATCCNNTCTCTNTAANAAAATGNGATGGAANNAAAAGGGAGGGNGANATANTNGTAG
ANNACGNGGTNGGNNNCNNGANAAGCANCCAGATNNNGAGGCACANAGTANAACANGGGA
AACATANGTNCAGNNNNGTGATAGAATGCANGCNNGGNTAAACTGTCGGGNGTGNAANAN
TAANAANTNNNNNGATATNNCGNNTNTNNTACNNNTNNGNNNNNNTANNNAGNANANNTC
NAGAAGAANNTNNNCANNGGTATNNCCNNNTNAGNNNANNNTATNNNAGGGAANNATNNN
NNANNANTANGTANCGNNNNNNNTCGCNNGNNAAAGTGTGNANATNANN
Quality >S03036-02_B06.phd
19 17 7 6 6 7 18 6 13 17 10 10 16 6 8 6 8
8 7 7 5 9 5 6 15 12 8 5 5 9 21 36 33 17
19 27 23 35 11 23 25 20 12 21 22 21 26 30 29 27 21
27 25 21 23 19 35 24 36 21 20 27 33 32 19 42 46 46
38 29 24 41 52 47 33 53 33 26 45 39 24 31 45 24 53
28 40 47 46 28 35 42 35 34 38 21 37 41 40 32 33 35
32 35 39 39 28 35 53 53 52 57 52 52 52 52 53 53 53
60 60 60 50 52 60 60 52 53 53 53 57 60 52 57 60 52
57 53 53 48 46 60 57 58 63 53 53 58 53 53 57 60 57
57 57 57 60 57 50 52 57 57 52 52 57 60 57 60 57 57
57 57 52 46 53 52 52 57 63 53 53 60 57 57 60 60 52
60 57 60 57 50 53 53 53 60 57 60 52 52 52 57 53 57
53 60 57 57 60 60 53 53 53 53 53 42 53 42 53 40 38
31 37 50 41 52 53 53 42 42 44 53 53 53 41 53 53 53
53 53 53 53 60 53 57 57 53 53 50 50 39 53 46 31 44
42 19 37 47 40 41 34 42 40 14 14 14 40 12 18 9 19
19 27 16 26 23 20 12 12 14 9 11 10 14 27 14 7 14
6 11 6 9 17 13 11 15 14 9 9 9 9 9 15 17 9
21 7 9 9 9 11 22 14 13 14 12 11 10 10 11 13 15
8 13 9 14 13 11 11 12 13 9 9 11 9 11 18 7 8
11 10 14 12 9 18 8 11 14 15 10 8 6 11 11 18 6
7 16 23 11 12 16 12 11 9 14 6 9 11 13 7 11 10
9 9 11 13 9 10 19 20 16 15 24 24 10 8 9 9 9
12 12 14 10 12 19 16 16 11 9 10 14 20 24 14 10 9
9 10 11 11 10 6 6 19 26 11 16 16 9 10 7 10 18
14 25 10 7 9 6 6 10 14 16 10 16 21 15 9 10 10
11 10 6 10 10 9 14 7 11 9 10 9 11 7 9 14 18
8 10 10 11 11 18 11 11 9 11 10 17 13 10 9 12 9
11 8 9 6 10 8 9 9 10 9 10 6 6 8 9 11 14
16 6 8 9 9 6 10 14 9 11 9 8 6 9 16 9 18
11 10 13 7 7 8 19 10 12 10 13 9 10 12 8 8 7
12 10 6 9 10 16 6 9 7 11 9 9 13 11 6 6 9
9 9 6 10 8 11 7 11 9 5 5 6 9 6 7 8 9
6 9 13 8 8 9 6 19 10 19 10 9 9 7 6 6 9
10 10 8 8 8 11 30 7 9 13 11 10 7 9 9 11 14
5 8 9 13 10 14 18 9 9 9 9 7 9 11 6 8 30
9 6 6 7 7 8 8 9 12 9 16 9 11 13 11 11 8
9 6 9 9 6 7 10 11 6 8 10 10 16 8 10 9 9
9 12 9 9 5 9 14 13 5 10 10 6 15 5 11 8 10
6 9 16 5 9 5 7 7 7 5 10 10 8 15 13 5 5
11 8 7 6 11 5 9 5 5 8 12 12 5 5 5 11 7
6 8 6 5 5 5 5 5 11 14 5 7 6 11 10 6 12
5 11 5 5 14 13 7 10 10 8 11 9 11 13 5 5 11
5 5 6 14 10 5 5 9 11 11 14 9 5 5 9 10 6
5 5 11 7 14 8 7 7 5 15 6 5 6 8 10 10 5
5 5 24 8 11 11 12 11 5 5 19 8 5 5 7 5 5
9 6 5 15 6 11 8 5 11 11 8 5 12 8 5 5 5
6 6 5 6 9 11 10 9 6 5 11 5 5 11 10 11 11
10 9 12 12 5 11 6 8 8 6 12 5 5