S03036-02_B07
Seqid S03036-02_B07
Sequence >S03036-02_B07.phd
GGGTTTTATTTTTTCGGCCCTNNCNNNNAGGNGATTGGCGGCGGGTCGGCCGANTTGTTT
GTACATAACCTTTTAAGGGGACCATACATATAACCAGAGCTAAGGTATTACGAAAAAAAA
AAAAAAAATACAAAAANACTTCCATGAAAAAAAAAAAAAAAAGGGAAATTCCCGGCAATA
CGGGCCAGCTTGAGTATTCTANAATGTCCCCTAAATAGCTGGGCGTAATCCTGGCCGTAA
ATGTTTCCTGTGTGAAATTGTTATCCGCTCACATTTCCACACAACATACGAGCCGGAAGC
ATAANGNGTAAAGCCNGGGGTGTCTATTGAGTGCATTAATTCCCTTTATTTGCGTNNCGC
TNNCTGCCCGCTTTCCAGTCGGNAAAATTGNTNTGCCCATTGCATTAATGAATCGGCCAA
CCCGCGGGGAGAGGGGGTTAGGGTATTGGGGACTCNTAAAAAGCATCACTCACTGACTCC
CTNNGNTNGTTCNTAAAGGTGGGGTNNNGANAANNNCTCGTATNAAATTANANAANAGAA
AACCAGCAAAAAAGGGGGATTGCGNGGAAGATNTTAGGGGTAAAAAANAANATNTGCCNA
GACAACCCGCGAGGGGGGGGGAGGGGGGANAAGGAGGATTNATATNTNAATAATAAAGCA
GCAAAAAANAAGTAAGATGCANATTGCAATTGTTGATTTNANATAANAATNAAAGNCATG
CNAGTCATAAAGCAGGGTNGATANNNNGGAAATATGAAAAAGTAGAATTTAAAGCATTAA
NNNATGAGAGNNGTGCNNAAAACGCGGAATAGAAGGCTAAAAANANTANNAGNANAGNNT
TGNNNAGTTCCANGTGNTNGAAGNTGTTTNGNNAN
Quality >S03036-02_B07.phd
20 8 9 8 16 9 10 9 8 8 9 15 14 15 9 8 8
10 17 12 9 7 6 8 5 7 5 6 9 13 9 5 12 9
12 18 26 15 17 17 13 12 10 9 8 22 22 22 28 31 33
24 24 7 23 47 12 16 19 10 10 13 9 20 12 17 16 15
10 23 9 10 18 35 23 23 10 19 13 19 10 9 13 14 9
13 19 9 21 11 18 13 30 31 19 9 11 17 10 16 22 11
13 14 27 19 38 35 20 11 18 12 19 14 16 12 16 13 11
11 14 18 18 19 38 32 19 24 11 9 11 9 9 11 9 10
6 11 14 14 13 24 28 10 20 16 9 11 8 11 9 9 11
19 24 10 14 11 28 44 27 27 11 10 12 14 38 11 11 9
9 35 19 35 23 11 9 9 24 13 9 12 19 10 18 18 13
11 13 33 27 27 32 10 9 16 19 13 22 9 11 7 9 9
11 18 11 13 9 20 18 8 19 13 10 10 11 13 34 13 10
18 23 19 11 10 11 9 39 39 18 23 34 14 9 9 11 10
19 10 9 13 25 32 41 25 20 10 11 13 9 10 11 14 27
15 23 23 24 21 29 35 10 19 19 16 9 18 18 16 11 19
13 11 20 23 15 14 12 15 9 13 9 11 9 22 13 9 9
9 13 9 13 10 19 22 36 22 14 13 9 9 32 17 6 9
7 13 34 14 19 13 12 11 10 7 12 20 18 25 16 10 8
9 10 24 10 10 13 11 15 9 11 9 9 13 13 18 23 14
13 10 13 11 13 15 18 26 13 18 18 28 18 12 11 6 7
9 12 14 9 6 6 9 28 24 10 15 12 10 15 32 40 31
11 30 20 11 16 10 10 19 6 18 19 10 8 8 10 20 6
9 7 9 9 13 18 9 11 11 9 22 28 29 37 37 30 9
24 23 34 20 9 18 26 10 18 19 24 12 11 22 19 16 18
21 21 16 9 20 20 21 22 16 11 13 32 39 19 11 10 8
10 13 18 20 18 17 19 20 9 9 9 14 9 6 9 13 14
14 11 8 9 8 11 9 21 10 15 18 13 18 19 10 14 11
18 15 12 15 19 14 6 6 11 6 10 6 18 9 10 14 7
22 9 8 11 11 9 14 16 12 12 19 16 6 7 7 13 11
6 9 9 6 6 6 11 15 10 9 10 11 11 6 18 23 16
11 11 14 6 9 6 10 10 6 11 14 9 11 35 16 10 9
21 15 10 10 14 13 16 12 11 10 18 27 27 13 9 11 9
10 10 10 6 10 9 13 19 10 17 9 7 14 11 8 15 14
11 12 14 18 18 12 35 14 18 6 9 8 6 9 11 6 10
10 10 11 6 9 10 8 10 11 9 11 13 9 8 16 10 14
11 9 10 14 9 29 17 24 24 20 13 9 11 11 15 15 10
6 8 9 12 11 23 13 9 10 14 9 6 10 11 28 28 6
11 6 11 11 10 14 10 12 13 24 11 9 9 9 10 13 11
14 9 15 23 10 6 10 15 10 9 12 11 13 10 12 17 11
14 6 9 11 9 15 10 19 17 8 14 15 15 22 12 12 9
10 10 6 11 6 9 11 25 27 6 19 29 9 6 10 11 19
13 7 10 13 8 9 9 7 9 8 8 14 9 13 11 14 9
9 9 11 8 10 8 9 6 11 14 10 14 6 6 6 6 11
11 13 9 8 9 11 10 13 19 12 11 10 10 8 9 10 10
9 12 11 9 10 10 9 10 9 10 9 11 8 9 10 6 6
6 10 10 11 8 10 9 11 6 6 9 9 9 11 6 7 8
9 9 9 11 9 9 10 10 9 11 12 13 11 12 11 10 14
13 11 17 9 8 14 9 6 12 6 9 9 6 6 10 8 6
11 6 8 11 6 6 9 9 11 6 6 6 9 9 11 11 10
9 10 6 12 9 11 6 9 6 10 9 10 8 6 8 11 9
9 10 6 8 6 6 8 6