S03036-02_B09
Seqid S03036-02_B09
Sequence >S03036-02_B09.phd
NNNNNNNTNNNNAGGGNNNNNNNNNNNANNGGCGATTGGCGGCCAAATCGGCCGAATTGG
GAAGTGTGACAACAGTGAGCTATAGGCACATTGCAGTGTACATCTACTGCAAGAGCTTGC
ATTAATTTTGATATAAAAAAAAGGACCATCAAATAATATTTGCTATATTTAAGAATGTCG
GCGGCTATCGAAAAAGAAACCGGAATGTTGGATGTAGGAAAGCACTGTGCATATTGTAGA
CAACTAGACTTCCTACCTTTCCATTGTTCGTTTTGCAATGAAGATTTCTGCTCGAACCAT
AGACTTAAGGAAGATCACCACTGTAGGTGGTTGCTAGAGCATGAAGAAGTTCATAAAACT
GAAAAGAGTCCTAGCAAAAGCCGGGATGGCTCAAGTTCTAACGATGAAGCATATTTCAAG
AGTCTGTTACCTGAGAGGGCTAGTGTTAGATCCAGANANTAAGTGCACAACCACAGCCCT
TGAGAGGTGGGAGGAGGGGCAAAGTGAATTTTTATTTTTTATCTTAAATAAAATAAACAA
AAAATTTAGGGTCATCCAAAAGGAAAGAGAAAANAAAAAATAAAAAAAAATAAACAAAAA
ATTTCTTTTCCTCCGCGAGGGGAGGNGAGGAGTAGATTTATTTTTATTTATTTTTATAAA
AAAAACAACCAAAAAACGAATAAAAGTNGAATTTTCGTATGGANGNAACGGGATANGANA
AAAAACCCCACCCCCCACCCCCCCGGGGAGAGGGGGGGAGGGGGGAGTTANTATTATATA
ATNNAATTAATAAAAAGATAGCTTCNANATGCACAGNGGGAAGCGTCGGGGGGTCGGGTA
TAATNNACTCAAAACAACCACCCCCACAGGAAGAAGAGAGGGGGTGAGGGGGTATGTTTT
ANATTTTATNNT
Quality >S03036-02_B09.phd
4 2 4 5 4 5 7 8 6 5 5 5 9 16 13 8 5
3 5 7 5 5 5 3 7 7 7 15 6 6 15 16 9 15
13 26 30 26 13 15 19 20 16 21 15 11 24 42 44 36 28
35 35 31 31 12 29 31 29 18 23 16 21 35 33 43 38 50
25 26 32 32 40 28 29 32 35 31 35 36 35 40 37 41 27
29 35 36 46 46 43 47 54 42 32 24 29 33 27 33 42 32
50 50 42 43 50 50 50 38 36 32 27 45 43 50 54 54 54
42 42 50 44 46 46 50 53 47 46 49 44 54 43 49 47 60
60 60 60 60 60 50 60 60 41 45 50 47 60 50 60 59 60
50 49 54 54 63 63 63 63 63 58 45 54 54 59 54 60 50
54 49 49 63 50 52 63 54 50 49 51 51 50 53 50 51 57
59 51 49 57 57 57 53 53 57 57 53 49 44 53 51 53 53
45 42 53 50 49 46 49 45 45 49 49 50 49 43 34 41 43
43 49 47 46 50 46 50 49 46 60 60 42 33 43 60 42 33
40 47 38 30 44 41 44 47 54 45 49 49 63 63 60 54 60
50 60 49 63 50 54 47 50 49 63 63 63 57 54 54 57 63
63 60 58 54 54 50 54 60 57 63 49 42 44 60 60 60 54
52 50 57 58 54 50 60 49 58 50 54 60 47 45 49 49 63
47 60 47 49 49 60 50 44 44 49 60 50 50 54 58 63 63
52 60 42 52 57 57 58 52 60 57 57 60 42 22 23 15 35
34 42 36 29 28 28 32 19 18 29 28 34 35 47 29 33 26
31 31 47 47 34 29 29 35 34 47 60 39 47 47 52 60 57
43 30 24 43 60 47 47 42 41 32 29 31 40 35 28 30 44
26 17 22 40 60 57 47 46 47 46 52 52 57 60 46 52 60
37 47 46 46 57 46 47 46 47 32 37 41 57 35 35 41 30
35 21 30 37 42 42 52 41 22 9 26 17 53 39 31 46 46
46 31 53 14 14 10 8 9 18 10 13 14 9 35 6 23 7
19 29 23 14 24 19 19 24 11 15 10 18 20 15 24 13 11
39 18 10 11 17 9 11 11 22 27 42 9 21 17 12 10 11
11 9 10 15 27 13 10 10 11 16 26 14 9 11 12 11 11
20 11 16 14 20 40 40 46 27 14 15 14 12 20 9 10 13
21 11 16 11 13 12 9 34 11 19 10 14 22 40 27 11 18
16 14 16 8 8 9 9 9 9 10 14 17 32 17 10 10 10
18 32 11 13 10 10 9 9 24 17 41 10 6 9 19 28 22
21 18 9 20 14 18 10 14 28 34 32 25 10 18 17 21 14
11 14 10 9 9 10 9 14 9 9 9 9 14 11 14 12 10
18 13 10 10 12 11 19 26 18 13 9 9 9 7 22 17 18
13 11 16 16 17 19 15 16 17 19 16 28 28 28 19 28 14
14 13 11 19 14 11 23 14 19 24 19 11 46 20 18 14 27
24 22 12 10 10 16 11 15 37 19 32 32 14 11 11 11 17
10 10 11 9 15 20 8 6 12 19 15 15 18 11 12 12 12
14 15 18 13 22 17 7 9 6 9 11 11 22 13 11 9 9
18 7 11 15 7 25 33 23 9 14 11 14 13 17 19 18 16
15 15 15 15 14 16 20 28 18 19 10 8 11 19 16 15 11
12 17 12 17 16 20 15 15 15 26 17 9 11 9 28 11 10
12 11 13 8 14 6 10 14 16 13 19 10 8 8 12 11 9
6 7 22 50 11 18 13 15 12 20 19 16 37 22 21 18 24
26 16 13 11 13 13 7 10 7 14 15 11 11 12 14 22 10
7 11 21 9 21 12 13 9 12 11 11 12 32 23 19 14 10
14 13 11 9 11 9 16 26 27 12 19 6 6 14 10 10 9
24 18 14 15 13 15 11 13 14 11 32 11 26 11 13 9 11
15 13 11 11 10 11 14 11 22 17 17 12 12 22 11 15 14
12 46 13 17 11 14 15 9 11 11 11 14 13 13 8 11 10
7 11 11 9 8 8 11 11 5 5 16