S03036-02_B10
Seqid S03036-02_B10
Sequence >S03036-02_B10.phd
TNNNNNNNGGGCNNTTGNCGGCCAAATCGGCCGAATTCCCATGGGGATCCGATGAAGAAC
CCAACAGTTGAGGCGCCAGCTTTGGTAATAGCTTAATAATAAATAAAAAAGATAATATAG
CTAGCTAGTATTATTGCTTTTATCCGTATGGCCACCACCACGCAACCACAAAATATACTG
ATGGATGAACCTTTAAATCTTCCTAATAACAGTGCCCACAACAATAACTATGGAAACATA
AATGCGAATGTAAGAACTTCTGCTGGTATGAGCATGCACATGCACCCTGCCAGGCTGAAC
TCTCTGGAGTTTTTGCACAAGCCCAGGAGACTATCTAATGTAAAACTGCACAGATTACCT
CAGGACGAGCTTCAAAGAAATACGGACATGAATAAGGGAATGTATTTTAATGGGAAACAA
GTTCATGCCCATCACCCGTTTATAAATTCTGGAGCGAACTTTAACGCACATCATCAAGAC
GTCAGTAAATTAGGCGAGGAGGAAGACGAAATCTCTCCTCCATCACATGATAATTTCCAG
TACGAATCCGAGGAAAATGGTAATCCTTCACCTCCCATTTACAAGAAATCTGGAGAACTG
GTTAAGAGGTCATTAAAAAGANTATCCAAGTCCCTACCCANTNCTCCNAAATCAATATTC
ACAAAACTGGGCTCTAAGANTAAACATGGAAATTTTAATCATGTCCCTCCTACGCCTCTT
CCCATAAAGCTGTTCAAGNAAAAGAAAAAACCATANATGGAGGCNATCAAGTGGTTTAAA
AAGAAAGTTCAGAATATCACCGCTCACCCTTAGACGAAGGGGATGGGGCGGAGAGAGGAG
GGAAGTAAATNNTTANAATAAAN
Quality >S03036-02_B10.phd
8 5 3 3 5 5 4 5 11 19 27 12 7 7 12 21 22
6 9 20 18 11 10 12 18 27 32 42 41 19 25 42 44 41
13 26 34 24 23 14 11 28 50 50 42 42 12 13 35 35 30
42 24 40 42 38 35 50 44 26 40 35 31 43 35 31 31 35
50 51 54 46 41 35 30 42 42 32 35 43 54 54 54 50 42
54 54 46 44 44 44 54 54 50 54 59 59 54 49 46 49 49
49 60 54 60 59 60 60 49 49 44 44 60 49 50 54 54 50
52 59 50 50 54 54 50 50 60 54 54 50 52 60 54 54 63
63 60 63 63 51 54 57 60 63 49 54 60 54 54 58 54 57
60 63 58 52 58 58 58 63 63 63 63 60 63 63 58 63 63
58 58 63 58 63 63 63 63 63 63 63 63 63 58 63 45 57
58 51 52 51 50 54 50 60 60 60 54 59 60 59 60 60 57
58 63 60 60 60 54 44 50 60 46 43 43 47 47 60 36 38
40 47 50 54 54 49 50 50 58 60 58 63 63 60 51 50 50
58 51 60 51 63 63 63 51 63 49 47 63 60 60 63 60 63
57 50 53 53 53 53 53 53 53 53 53 51 52 52 57 53 54
57 59 57 57 57 50 57 54 53 53 59 59 57 54 57 57 53
57 57 59 51 53 57 57 57 57 51 50 57 57 57 59 57 57
53 50 54 53 53 53 51 51 44 54 42 50 46 46 44 50 51
50 46 44 43 45 44 45 50 54 54 54 54 54 54 59 54 57
49 54 54 54 54 50 53 53 57 54 54 57 50 42 50 57 54
50 50 51 54 59 59 57 42 50 50 54 49 49 49 49 50 50
50 51 49 53 53 46 46 51 50 54 57 57 42 50 54 54 57
50 54 50 49 47 57 49 49 54 38 57 42 54 43 53 53 46
40 46 49 53 51 51 54 50 54 54 54 54 54 54 49 50 54
54 57 50 54 49 50 54 54 49 49 49 50 50 54 49 32 42
46 32 49 49 54 50 50 42 49 49 50 46 46 42 43 46 35
46 49 42 43 42 46 50 42 42 35 39 40 39 42 39 35 44
50 50 54 42 42 54 54 42 54 54 50 49 43 38 50 42 23
46 42 42 50 24 50 42 29 54 54 54 24 50 23 35 57 59
54 42 42 42 50 59 44 50 54 44 59 43 54 39 36 28 21
32 42 42 39 39 39 38 50 54 44 43 22 50 49 29 44 36
54 44 44 39 59 42 52 26 54 44 59 59 44 26 39 39 17
20 17 16 22 38 30 32 28 14 26 36 39 44 44 31 22 35
33 35 22 42 16 22 15 28 30 36 44 60 35 60 60 33 24
26 28 24 24 32 27 14 9 18 19 16 44 22 17 12 9 11
15 24 44 44 44 44 35 12 9 7 9 12 21 16 29 23 29
23 19 17 24 19 16 16 32 29 20 10 7 9 6 9 25 18
27 6 25 31 44 20 20 11 28 9 20 16 17 10 13 10 10
23 22 20 20 30 41 31 11 9 8 10 10 11 47 41 14 6
9 10 46 44 14 27 37 14 10 11 23 32 23 19 19 13 12
22 12 12 14 10 11 10 22 11 11 11 14 12 9 8 13 15
16 13 12 10 12 15 11 13 11 10 13 11 15 41 11 11 17
21 20 15 28 34 20 10 7 26 50 12 18 13 11 12 14 40
15 11 17 17 16 14 9 6 11 13 10 9 9 13 26 14 7
16 11 10 19 24 15 10 16 15 12 11 9 14 18 11 15 11
9 18 16 16 17 10 10 10 11 11 9 12 9 9 13 13 25
22 33 9 11 8 10 8 11 32 32 13 10 10 14 20 12 18
15 12 15 12 12 13 14 8 20 15 46 19 11 27 10 18 16
28 11 11 18 14 11 13 14 22 14 11 10 11 14 11 16 11
6 6 8 8 12 7 13 16 13 10 14 10 6