S03036-02_B12
Seqid S03036-02_B12
Sequence >S03036-02_B12.phd
NNNNNNNNAAGGGGCGATTGGCGGCCAAATCGGCCGAATTTTGAGGTAAAATTTAGTACG
ATAGTAAAATACTTCTCGAACTCGTCACATATACGTGTACATAATGTCTGAACCAGCTCA
AAAGAAACAAAAGGTTGCTAACAACTCTCTAGAACAATTGAAAGCCTCCGGCACTGTCGT
TGTTGCCGACACTGGTGATTTCGGCTCTATTGCCAAGTTTCAACCTCAAGACTCCACAAC
TAACCCATCATTGATCTTGGCTGCTGCCAAGCAACCAACTTACGCCAAGTTGATCGATGT
TGCCGTGGAATACGGTAAGAAGCATGGTAAGACCACCGAAGAACAAGTCGAAAATGCTGT
GGACAGATTGTTAGTCGAATTCGGTAAGGAGATCTTAAAGATTGTTCCAGGCAGAGTCTC
CACCGAAGTTGATGCTAGATTGTCTTTTGACACTCAAGCTACCATTGAAAAGGCTAGACA
TATCATTAAATTGTTTGAACAAGAAGGTGTCTCCAAGGAAAGAGTCCTTATTAAAATTGC
TTCCACTTGGGAAGGTATTCNAGCTGCCAACNAATTCGGAAGANAAGGACGGTATCCGCG
GNAAATTGACTTAATTATATTTTTTTCGNTCAAGAAGTTNCCGGTGCAGAGGCCCGAGCN
ACTTTGGTTTCCNNTTTTGNCAGAAGAAAAAAAGAAAGAAAANNTCAACCCCACAAAAAA
TGACANAGGGAGGGGAATGGGGTGAGTTTGTNTCAAAAATGAAACATTTCGCCGCAAAAC
CAAGTAGAAANAAAACAGGCAAGAGTAAGGGAANGAGTAGCTAGGNANAAAAAGGAACAG
TGCNGTCAAAGGAANNGAAAGNAGATNATCACCTTAATTATNCGNAGN
Quality >S03036-02_B12.phd
5 5 5 5 6 6 6 6 8 8 8 12 15 21 8 9 9
8 9 9 12 10 46 21 14 19 10 10 20 31 42 40 22 30
43 48 43 17 24 52 49 41 29 40 46 33 14 30 33 36 31
30 49 49 42 22 30 36 42 35 54 35 43 43 42 42 39 39
28 28 35 50 46 44 44 43 50 42 47 60 50 47 47 42 47
47 52 60 52 60 57 57 60 52 52 57 57 57 57 60 52 60
57 57 52 52 57 60 54 52 52 57 54 52 48 52 57 57 52
57 57 60 60 57 63 63 57 57 57 57 60 60 57 52 52 63
63 63 63 58 58 59 59 57 57 63 63 63 63 63 58 59 58
57 60 59 59 63 63 63 63 60 58 57 63 63 63 63 60 59
63 60 57 52 63 63 58 63 63 60 63 63 60 60 58 53 63
58 63 59 60 58 57 58 63 57 53 52 52 63 63 63 63 63
63 63 63 58 57 59 60 58 59 52 52 59 59 59 60 57 40
37 35 26 43 48 52 60 57 57 58 53 63 63 63 57 60 57
60 58 58 53 58 63 63 63 52 60 57 60 63 63 63 63 63
60 60 60 63 58 59 60 63 58 63 63 57 52 54 60 52 52
60 57 53 53 54 57 60 63 63 60 58 60 58 58 54 60 59
57 60 57 57 54 57 57 57 52 57 57 63 63 63 63 54 59
63 57 63 54 59 57 52 60 59 59 60 60 59 57 60 52 57
59 54 60 54 60 59 60 59 54 52 57 57 57 60 57 57 57
52 63 54 59 59 57 57 63 63 57 63 63 58 52 52 58 52
57 63 60 58 60 52 52 57 59 57 52 63 63 58 53 57 60
60 57 57 57 57 52 57 58 57 58 60 60 60 52 57 52 47
52 52 60 57 52 60 57 60 60 52 42 60 54 52 57 57 58
57 52 63 57 57 52 57 57 60 57 57 57 52 35 63 58 53
58 52 60 60 57 52 52 42 52 57 60 52 57 53 46 58 60
41 57 52 60 40 35 52 57 52 42 52 60 60 40 52 60 57
52 40 57 52 52 57 57 60 41 20 43 48 40 52 47 52 57
52 48 47 60 57 47 47 46 47 52 52 57 48 46 52 57 52
52 52 57 57 48 30 39 29 57 34 23 15 31 48 28 52 46
52 46 46 40 16 48 57 52 52 48 20 24 37 32 41 29 30
32 32 37 32 37 32 34 26 23 26 35 35 35 37 46 42 24
19 34 35 46 35 14 16 26 42 34 23 16 21 16 11 11 7
9 10 23 18 46 47 28 9 11 9 5 15 16 20 20 8 12
12 41 28 14 14 7 35 46 16 13 14 13 16 42 19 27 20
28 13 9 9 11 32 7 18 14 9 11 11 13 22 18 13 10
9 14 23 19 16 16 8 11 9 14 11 10 11 11 9 9 6
18 12 14 18 19 9 11 13 16 16 6 10 13 9 9 9 13
10 10 10 24 16 13 12 9 8 8 11 15 11 6 11 9 11
11 19 11 9 9 15 12 16 14 6 6 19 20 18 14 13 6
11 11 10 12 27 27 17 16 9 9 9 14 13 20 35 22 13
10 19 10 10 9 6 7 11 13 11 11 11 9 9 10 10 11
21 28 20 23 11 22 13 11 18 10 19 6 13 9 11 9 9
8 9 9 11 27 13 10 10 10 14 8 9 11 13 8 23 11
9 12 10 7 10 11 19 12 11 13 12 9 8 14 11 12 12
11 11 11 9 11 11 9 8 8 11 16 20 10 8 12 11 11
10 9 14 18 13 11 10 10 6 10 32 11 9 10 9 10 17
11 9 11 11 15 15 11 9 10 18 11 21 8 9 6 8 17
11 9 20 21 11 16 11 15 8 7 12 7 12 14 11 11 18
13 14 24 14 11 9 10 13 12 9 6 9 14 16 11 11 19
10 11 12 23 6 6 11 22 17 15 9 6 11 13 12 10 6
11 10 9 8 9 11 9 8 8 9 10 11 14 14 6 11 8
7 11 10 6