S03036-01_B19
Seqid S03036-01_B19
Sequence >S03036-01_B19.phd
GNNNNNNNNNNTNNNNNNCNNNNNNNNANNNGGCGATTGGCGGCCNNTCGGCCGAATTTG
GGACGTGCACATGTTAATGTTATATACATATATAGATATAGATATATAATTGCAATAATG
AACTACAAATTAAAAAAAAAAAAAAAAAGTACCGGCCATAAGGGCCAGCTTGAGTATTCT
ATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTG
TTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGG
TGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTC
GGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTT
GCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCT
GCGGCGAGCGGTATCAGCTCACTCANNGGCGGTAATACGGTTATCCACAGNNTCANGGGA
TAACGCAGGAAAGNANNTGTGAGCAAAAGGNNAGCAAAAGGNCAGGAACCNGTAAANAGG
GCGCGTTGCNGGCGTNNNNCNTANNNTNNGGCCCNNNGANGAGGATCACAAAATTNACGC
TNAGTCAGANNGGNNAANNNANNGACTATNAAAATACCANGNNNTNNNNNNGNAGNNNCT
GTGGGTANTCNGNNNGANNNAGTNGNNAACNNNNNNAGANTNTNNNNTNNNNCCAAAACG
NNNGANTNGGAANACGAGGNAAAGGNGNTANNTAAAAANANNNAANGTANAAGGTNGNNT
GGGCAGANATCNNGGAAANGNTAATNGGAAANAA
Quality >S03036-01_B19.phd
12 4 2 2 3 3 3 3 4 3 4 8 5 7 5 6 5
7 9 5 7 6 5 5 5 5 5 8 5 7 5 10 14 9
19 23 10 22 23 14 13 31 26 13 9 7 7 41 37 47 29
45 46 43 29 12 26 51 37 35 38 38 17 13 50 50 50 50
22 31 35 49 47 46 31 46 46 40 49 46 31 46 35 46 49
49 42 21 49 50 49 49 49 42 54 42 46 46 49 42 54 42
59 52 54 59 59 59 54 50 54 54 50 39 38 47 50 44 44
46 33 38 32 44 50 50 42 49 49 50 51 50 50 51 47 46
49 49 54 49 49 49 49 49 46 46 49 50 50 54 50 44 50
46 42 46 51 50 54 50 57 50 53 45 46 46 42 54 50 57
50 50 44 44 50 42 50 53 42 50 42 49 50 50 49 54 59
50 44 46 42 29 43 51 51 49 46 54 54 54 51 54 57 50
54 50 50 50 50 54 44 54 54 50 50 54 39 43 50 54 54
59 59 54 49 46 42 45 42 57 39 50 42 54 44 29 43 42
54 50 42 49 39 46 43 52 44 42 49 42 36 36 39 49 50
50 39 46 22 44 35 39 39 57 38 39 42 39 54 39 50 31
54 57 39 53 45 45 35 50 27 42 35 57 51 42 35 43 27
35 49 42 28 35 57 30 54 57 47 53 35 50 19 42 31 35
43 26 39 30 26 35 43 33 19 42 44 30 50 33 33 28 22
35 28 35 57 32 57 37 53 43 30 32 41 51 29 30 26 32
30 26 24 31 35 46 27 51 53 27 35 38 57 51 30 49 30
35 35 32 30 51 43 28 42 46 33 50 36 46 35 41 33 35
46 29 46 16 35 49 49 35 49 30 46 49 35 42 37 50 49
52 33 41 38 42 43 49 35 50 31 32 41 42 46 46 53 53
53 35 20 26 15 49 30 34 43 30 49 45 28 30 26 40 28
40 40 35 50 49 21 35 32 36 28 34 49 21 43 31 32 38
41 26 31 32 27 34 32 43 28 31 28 31 29 29 14 40 28
27 35 46 38 26 18 32 27 21 20 35 20 30 23 32 46 28
19 46 18 37 30 28 11 44 25 27 40 18 29 28 27 24 32
26 18 29 20 36 37 28 28 32 35 28 8 3 7 16 33 18
19 32 22 17 30 28 24 30 9 29 10 26 13 29 18 23 18
32 19 8 5 7 14 8 9 5 26 25 30 18 12 28 41 17
14 28 14 9 29 23 33 40 15 6 11 7 5 8 19 26 19
12 9 22 19 28 39 31 18 18 3 5 21 16 21 13 16 13
25 9 10 3 8 15 9 36 26 8 11 30 7 9 10 13 14
13 5 36 12 30 11 29 8 20 25 20 25 14 15 7 11 12
8 13 8 7 5 7 5 12 6 9 9 5 5 5 9 6 6
9 14 17 18 13 5 5 7 9 8 6 8 13 10 9 9 9
11 9 21 12 24 10 18 10 9 6 15 19 16 23 14 7 16
20 20 16 19 9 8 7 7 12 14 5 7 21 13 7 5 5
12 6 5 12 13 24 17 10 23 5 14 9 11 15 12 23 14
12 14 6 12 7 7 6 9 5 5 7 6 5 5 12 7 11
9 6 7 5 13 9 9 9 9 9 11 8 8 7 9 13 7
8 6 5 6 16 14 7 7 7 10 13 10 7 15 6 6 9
16 11 6 6 6 6 6 6 9 11 9 7 8 7 8 7 6
5 5 9 6 6 6 5 9 10 12 10 14 8 9 13 6 6
6 10 9 7 16 6 9 10 11 16 6 11 9 10 10 11 11
6 8 12 12 12 9 6 8 7 9 10 5 4 14 10 8 14
10 19 6 17 6 6 6 23 15 6 9 10 14 5 12 11 14
14 11 6 9 7 6 9 9 12 10 12 11 15 20 7 9 12
9 7 6 9 8 8 10 9 6 12 7 9 9 18 9 7 10
11 9 11 10 7 9 11