S03036-02_B13
Seqid S03036-02_B13
Sequence >S03036-02_B13.phd
NNNNNNNNNNNTNTTNNGGNCNNNNNANNGGGNGATTGGCGGCNANTCGGCCGAATTGAT
CTACCTCCAGCATCTCATAATATGTCTTCAACTGCTAAACACGACAGTAACGCTAGCCCA
AATTCTGACTCTGAAGACGGTCACCACCACAACAATAAGAAGGAATGCGCTATCGAATAT
CTGAAGGCACGGTTAAATAGTGCATCAGCAGTCGCTTGCGGCTACCTCCAAGCTTTTGTC
AGTAAGACGCAAGACTTTGCCAAAGTATGCTTTTTAGAACTTCAGAATCCCGTTGTCTTG
GTCAACTTGTTGCTGCATTCTTCAGTGGTATGTTATTTATGTAACGGGTATGCGAACCAC
AACGCCAGATTCTTGAAGGGGAAACCTAACTCTACAGTCTTAGCAACAACCGCCGGCGCT
CTGGGTCTTTTGACGCTGGACGGTATAATTTCAAAGAAATACTACTCCAGATACGACAAG
AAATAATAACATACTATTTAATAACATCCTTTCACACACTCACACACTCACACACTTTAT
ATACATATATTTTTATAACTATTACTGCTGATTTNAAAAAAAAAAATAACACATCCTCGC
NCCCCAGGGGGGGGGGTACCGGCCATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTA
AATAGCTTGGGCGAAATCATGGTCATAGCTTGTTTTCCTGTGTGAAANTGATAATCCGCT
CACANTNCCNCACACCCTACGAGCCGGAAGNANNNGNGNAAAGCCTGGGGTGTCTTATGA
ATTAACTAACTAAAANTAATTGCATTGCGGTCNCTGGCCCGTTTTCAAGTNGGAAAACNG
TANGGCNAGCAGCATTAATGAATCCNCCCAGNGGNNGGAGAGGGGGAGTAGAGATNGGGC
GCTTNTNNANNTANTGAGA
Quality >S03036-02_B13.phd
5 3 3 3 3 4 3 4 2 4 5 9 5 10 8 7 7
9 8 5 8 3 3 3 5 3 9 7 7 11 15 23 6 26
31 15 34 32 14 8 26 26 12 7 9 7 40 42 42 26 33
41 41 29 26 30 35 34 15 19 31 35 36 28 35 34 46 30
16 30 30 41 41 41 41 28 31 31 41 43 35 43 31 43 43
54 54 49 43 30 50 49 49 54 42 33 35 33 39 42 44 52
42 42 43 42 44 28 33 30 36 39 36 30 39 54 42 42 35
50 50 46 49 49 49 47 47 44 44 54 54 49 47 44 60 50
44 44 50 50 49 60 49 45 50 54 50 50 54 58 49 54 52
50 51 51 58 63 49 63 58 58 60 50 47 44 51 45 63 63
58 58 60 47 60 49 49 60 60 51 49 49 60 51 60 50 58
54 50 45 58 63 58 63 63 63 63 63 63 63 63 63 63 63
63 58 47 47 60 60 50 50 50 49 51 54 50 63 49 46 45
50 54 54 50 58 49 50 47 50 50 49 60 47 60 60 60 60
42 40 42 60 52 57 60 57 58 52 52 63 58 60 52 52 52
60 63 52 57 57 52 57 57 57 57 52 57 52 58 52 60 60
60 63 52 63 60 63 63 52 51 51 51 50 49 63 50 50 60
63 63 58 54 58 63 58 59 63 63 63 63 60 54 60 60 49
51 63 63 46 63 63 49 63 58 49 60 51 51 60 54 54 50
49 50 54 58 50 60 50 44 63 54 54 49 44 51 50 49 50
50 49 50 60 49 60 60 43 60 49 44 50 44 42 60 44 47
44 60 60 47 60 60 50 49 58 49 50 63 47 63 63 49 63
63 63 58 47 63 60 60 43 42 42 40 44 49 50 49 47 60
60 45 49 49 49 49 50 60 49 49 60 60 49 60 63 50 50
58 49 51 60 49 51 49 63 60 60 49 49 47 49 50 51 60
46 49 60 63 43 43 58 50 42 49 49 49 47 60 44 28 49
58 44 47 49 49 49 42 60 60 44 47 63 43 42 50 47 47
42 35 39 47 40 38 43 38 33 21 35 47 47 60 44 31 43
60 39 60 54 39 42 43 42 42 42 42 42 43 43 50 50 50
46 46 49 44 50 50 43 54 50 46 46 44 25 49 39 49 54
54 51 28 26 39 38 42 34 43 54 39 39 49 36 42 50 44
50 50 35 50 50 50 54 50 42 46 34 54 42 54 43 35 54
42 43 43 42 42 42 59 59 59 59 50 54 19 42 42 54 34
42 54 50 50 54 50 54 54 31 20 18 17 10 5 15 32 27
30 35 24 17 26 26 25 15 8 17 14 10 11 8 13 9 9
9 9 14 10 10 6 10 10 15 11 11 12 11 12 10 15 16
11 22 37 49 16 17 20 16 31 30 12 26 18 28 35 36 20
51 27 21 25 21 25 22 38 24 21 20 12 31 16 25 25 9
26 25 20 23 14 13 21 12 12 12 10 17 19 25 21 33 13
23 12 12 18 15 28 18 11 9 11 21 22 22 16 23 19 21
35 30 26 33 21 26 21 16 21 13 12 26 26 26 22 28 22
38 18 23 11 18 18 30 20 41 24 7 15 20 10 13 29 17
13 22 12 30 17 11 10 9 12 12 7 12 7 16 17 7 21
13 28 16 16 19 11 9 10 10 9 11 17 18 10 34 9 10
9 12 7 10 6 6 6 9 7 11 7 12 9 9 23 9 17
16 15 14 12 16 31 14 11 12 28 14 17 17 8 10 12 15
18 16 9 12 24 19 14 11 11 11 9 11 13 7 9 19 25
25 17 9 9 14 13 29 19 13 14 11 15 11 6 15 15 10
13 15 25 16 9 14 12 31 27 20 14 20 20 15 7 20 30
17 37 28 18 9 6 11 9 9 6 20 21 21 7 16 10 15
10 15 12 12 10 26 10 19 13 13 12 12 12 19 11 7 11
16 9 12 9 6 15 12 6 6 12 25 12 16 8 10 27 22
27 32 9 12 10 11 9 11 13 22 9 5 18 12 27 14 15
10 9 9 6 10 6 5 10 5 5 16 11 6 17 13 10 8
15