S03036-02_B14
Seqid S03036-02_B14
Sequence >S03036-02_B14.phd
NNNNNNNNNNNNNNGAATTGNCGGCCAATCGGCCGAATTGAAGATTGAAAATTCCCAGAC
AGTGAGCACCAGCACAATGACCGTTTACACAGCATCCGTTACCGCACCCGTCAACATCGC
AACCCTTAAGTATTGGGGGAAAAGGGACACGAAGTTGAATCTGCCCACCAATTCGTCCAT
ATCAGTGACTTTATCGCAAGATGACCTCAGAACGTTGACCTCTGCGGCTACTGCACCTGA
GTTTGAACGCGACACTTTGTGGTTAAATGGAGAACCACACAGCATCGACAATGAAAGAAC
TCAAAATTGTCTGCGCGACCTACGCCAATTAAGAAAGGAAATGGAATCGAAGGACGCCTC
ATTGCCCACATTATCTCAATGGAAACTCCACATTGTCTCCGAAAATAACTTTCCTACAGC
AGCTGGTTTAGCTTCCTCCGCTGCTGGCTTTGCTGCATTGGTCTCTGCAATTGCTAAGTT
ATACCAATTACCACAGTCAACTTCAGAAATATCTAGAATAGCAAGAAAGGGGTCTGGTTC
AGCTTGTAGATCGTTGTTTGGCGGATACGTGGCCTGGGAAATGGGAAAAGCTGAAGATGG
TCATGATTCCATGGCAGTACAAATCGCAGACAGCTCTGACTGGCCTCAGATGAAAGCTTG
TGTCCTAGTTGTCAGCGATATTAAAAAAGGATGTAAGTTCCACTCAAGGTATGCAATTGA
CCCGTGGCAACCTCGGAACTATTTAAAGAAAGAATTGATCNTGTCNNACCAANANANATG
GAGNNCATGGCGNAAANNCCATTGTTGAAAAAGATTCNGCCACTTTGCAAAAGAAAACAA
TCANGCATTCNCACTCTTTCCCNGCGNGAAGGNNGGANNCTTACCGTCCATATCCACTGT
Quality >S03036-02_B14.phd
4 2 5 3 2 3 3 4 6 4 2 5 4 3 28 11 9
13 26 15 5 8 19 21 18 16 26 25 32 42 42 19 24 46
47 32 17 26 32 29 18 18 24 15 13 31 32 31 35 37 29
28 45 50 50 26 27 45 51 39 35 49 41 49 42 49 49 28
44 43 42 51 50 49 51 46 46 46 49 42 43 49 45 40 49
43 54 49 31 49 30 40 38 40 41 46 46 50 46 41 46 43
46 50 50 42 40 50 54 54 50 51 49 49 52 50 57 54 50
50 54 59 59 54 50 49 51 50 49 49 50 49 50 57 57 57
53 53 53 53 53 53 57 57 57 57 42 42 50 45 60 63 63
58 63 63 63 63 63 63 63 63 63 63 63 63 54 58 57 54
58 63 63 63 59 60 63 50 50 63 57 58 57 52 63 63 63
63 58 63 63 58 59 58 57 57 54 58 59 63 63 54 60 45
58 63 63 63 50 54 58 50 50 54 54 54 50 45 44 54 49
47 43 60 63 63 50 50 50 49 51 49 63 58 54 58 63 63
63 63 50 63 63 63 63 63 58 63 50 63 60 63 59 54 52
63 63 63 63 63 63 63 58 54 59 63 63 63 63 63 63 58
63 54 54 63 59 63 60 63 59 54 51 60 58 63 54 54 60
59 60 57 63 63 63 63 60 63 54 63 63 63 59 63 63 63
58 63 63 63 63 63 63 54 54 63 59 54 44 60 58 60 59
59 58 54 47 60 54 52 59 54 49 58 49 60 54 63 54 49
42 39 63 58 51 50 54 63 54 58 50 50 63 44 41 50 57
60 58 57 60 58 63 63 54 60 50 54 60 54 63 58 60 58
54 60 54 54 49 46 53 53 54 54 54 54 57 57 57 54 59
59 59 59 59 54 57 57 54 59 59 57 51 52 59 59 59 59
54 57 57 57 54 49 50 54 57 42 57 57 54 54 57 57 51
53 46 51 50 54 54 49 57 52 54 57 54 54 57 54 54 59
59 59 54 54 51 39 54 57 51 50 54 57 54 54 54 54 53
53 57 54 54 54 54 57 57 50 54 54 54 57 54 50 50 49
46 49 54 54 54 54 54 54 54 54 54 54 57 54 49 44 46
50 49 50 49 46 50 49 40 49 57 50 50 49 53 51 46 50
50 50 54 50 51 54 54 54 42 49 46 54 54 51 50 50 51
46 51 57 52 57 46 49 49 57 50 35 49 46 40 39 50 50
49 49 35 54 42 50 44 59 54 46 49 46 46 54 49 49 49
42 50 50 54 19 42 42 28 43 50 42 50 54 50 49 43 43
47 42 43 28 40 37 42 43 54 54 43 36 35 46 35 28 42
31 54 23 54 54 19 46 35 35 54 36 18 36 43 43 15 30
49 49 35 49 17 46 29 46 26 35 43 42 43 35 43 42 16
43 25 27 32 35 42 32 42 36 42 28 36 38 29 17 31 46
37 38 35 54 41 38 35 54 54 15 16 30 12 36 22 36 33
25 43 28 36 18 43 46 21 14 16 13 21 35 30 31 18 29
32 30 20 41 41 28 46 35 22 27 23 16 23 20 8 27 16
16 19 13 33 30 28 18 18 19 18 35 18 20 29 17 21 20
13 15 15 15 11 15 13 28 11 30 22 41 17 12 13 20 18
9 16 16 14 22 28 26 9 26 15 14 16 18 26 30 19 17
18 33 26 10 26 31 35 27 20 16 9 9 6 11 14 13 9
6 6 15 14 19 14 12 7 14 5 9 6 9 10 9 11 17
13 6 7 14 21 25 28 17 20 17 6 16 23 9 7 7 8
41 21 19 21 28 19 11 20 19 17 18 18 11 11 19 13 19
9 6 16 20 14 14 20 15 15 20 14 11 13 29 13 13 16
12 28 13 15 10 9 11 14 11 16 7 8 9 14 8 10 10
7 8 16 25 11 11 11 13 23 20 14 10 7 10 8 8 7
10 12 11 19 11 7 7 18 11 9 6 6 10 17 23 16 17
12 13 14 12 14 18 12 9 30 9 14 8 11 11 10 8