S03036-02_B16
Seqid S03036-02_B16
Sequence >S03036-02_B16.phd
CNNNTTNNNNNNGGNNGCNNNNNNNAGGCGATTGGCGGCCAAATCGGCCGAATTGATATC
CAAGCAAGTCCAATAGCATAAACATTAAGCACGACAGCTGTAAAAAATGTCAAAGTTTGT
TATCACCTGCATAGCTCATGGAGAAAATCTCCCAAAAGAAACCATCGACCAGATTGCGAA
AGAAATTACTGAAAGCTCGGCGAAAGATGTATCAATCAATGGTACCAAGAAACTATCGGC
CAGAGCTACCGATATATTCATTGAAGTCGCAGGATCGATTGTTCAAAAAGACCTCAAGAA
TAAGCTGACGAACGTCATTGACAGTCATAATGATGTTGATGTTATTGTTTCTGTCGACAA
TGAATATCGTCAAGCCAAAAAGCTCTTTGTCTTTGACATGGATTCAACATTAATCTACCA
AGAGGTCATCGAATTGATTGCCGCTTATGCTGGTGTTGAAGAACAAGTGCACGAGATCAC
AGAAAGAGCCATGAACAATGAACTTGATTTCAAAGAGTCTCTAAGAGAACGCGTTAAATT
ATTGCAAGGCCTCCAAGTCGATACACTATATGATGAAATAAAACAAAAGNNAGAACCNCA
AAGGGGTGTNTCGGGACNNTGCAANNTGNNTGATAAAAAAATTTNAAGATCGCCGTTTTA
AGTGCTGGTTNAATTTAGGTTANCCGAGANTTCGNGAGAAATTAANGANANTTTTTTTNC
NNGGAAAGTGGAGGAAATTGGGNCCTATGGNNCATTAACATGAAANACGTGANAGAAGGG
NCAAANNTGACCATGNAAGAGNCAAAAATNTCAGGGGACATAANACAGAATAAACAAATG
AGNAAAANGAAGGAGTGANANAAGANAAGGANACACNANACATNAGCCAAAGGAGAAGN
Quality >S03036-02_B16.phd
10 5 4 4 8 11 6 6 5 6 2 7 18 8 7 5 10
8 5 7 5 7 7 7 7 9 23 25 10 23 20 16 42 31
10 14 35 23 16 20 11 13 25 35 35 47 26 40 31 35 28
16 32 30 25 8 26 23 38 37 19 20 41 38 32 24 25 32
44 34 28 28 42 37 38 30 32 35 43 41 36 46 46 32 31
35 36 49 49 50 32 33 32 27 43 33 42 43 35 46 32 26
26 26 29 22 30 24 33 36 38 36 36 42 42 39 35 47 47
47 47 60 50 50 60 47 49 49 50 47 47 49 49 47 50 50
57 52 57 57 60 52 52 52 63 63 52 63 63 63 63 63 63
57 58 63 63 57 58 60 52 57 57 52 57 57 60 52 52 52
52 57 58 63 63 63 58 57 63 63 60 53 63 60 52 58 63
60 53 53 63 63 63 63 63 63 63 63 63 63 53 60 57 57
60 52 52 52 52 57 57 54 57 57 57 57 54 59 57 60 63
52 60 52 52 52 57 60 54 52 60 52 52 52 52 43 41 60
48 47 43 43 47 52 52 57 52 60 53 60 57 52 57 57 63
60 63 57 52 52 54 58 60 57 60 60 60 63 53 57 63 57
63 52 52 63 63 63 52 63 63 63 63 58 60 59 60 60 60
57 52 52 63 60 63 63 63 63 63 52 52 60 53 52 58 58
63 63 52 52 63 63 57 57 60 57 60 57 58 57 52 54 58
60 60 58 60 57 57 57 54 60 52 54 52 57 57 57 53 52
52 52 52 57 52 60 52 52 57 57 57 60 52 57 59 57 52
57 60 60 57 58 63 57 52 52 52 57 63 58 52 52 60 60
59 52 57 57 57 60 57 52 57 60 60 57 60 57 57 60 57
60 57 57 60 57 52 60 52 60 47 52 46 57 57 57 57 60
60 57 57 60 57 52 58 57 57 60 52 60 52 63 52 57 52
57 60 57 54 60 52 52 52 52 57 52 57 52 60 52 47 52
52 52 54 60 60 52 52 52 60 57 52 57 57 52 52 46 47
40 47 57 42 43 22 32 32 35 52 57 29 23 40 57 57 52
57 60 60 57 52 52 42 40 40 42 57 59 52 52 44 46 40
14 14 35 52 48 60 57 60 60 46 40 57 57 54 52 52 52
39 44 60 52 46 52 34 42 47 57 60 52 35 34 21 35 28
57 57 21 35 42 42 23 13 37 47 44 39 30 30 31 28 16
16 18 47 52 46 16 25 29 29 28 44 35 44 34 27 16 34
28 16 20 20 28 14 19 17 24 19 27 35 32 35 26 35 20
17 13 22 16 13 18 12 16 9 9 9 6 7 18 8 18 8
8 9 7 9 8 9 16 16 17 17 19 9 14 13 6 9 9
9 9 9 9 11 6 6 8 9 12 19 8 6 6 9 10 6
6 11 9 8 8 12 16 32 12 19 26 41 20 17 11 6 10
19 12 11 10 13 10 16 19 10 14 28 14 16 25 11 9 10
11 9 9 27 22 11 14 6 8 11 12 11 13 11 10 8 17
19 10 7 8 11 13 12 14 11 7 9 9 8 10 6 11 10
11 9 16 16 12 14 19 10 7 10 11 7 10 7 9 10 11
15 11 10 11 6 10 7 7 8 9 8 14 11 12 10 9 11
15 21 22 18 17 14 11 14 10 14 9 6 16 9 8 10 9
11 11 6 6 9 14 13 11 11 18 9 9 9 18 22 25 15
6 18 14 13 11 14 14 7 12 11 11 28 20 12 11 6 10
8 10 9 6 6 11 9 13 14 13 11 12 11 6 11 11 16
11 14 7 10 12 12 11 18 18 11 6 8 11 12 13 11 10
13 8 9 19 9 16 12 6 14 9 18 14 16 9 12 13 9
9 9 11 14 11 9 8 10 9 6 11 9 8 9 7 10 9
11 16 11 14 8 10 10 10 6 8 6 12 11 11 8 6 8
8 11 11 8 6 13 11 10 9 7 14 6 8 8 9 11 6
14 9 10 9 10 11 19 9 8 9 12 8 11 10 6