S03036-02_B18
Seqid S03036-02_B18
Sequence >S03036-02_B18.phd
NNNNNNNNNNNGGNNNTTTGGCGGCCAAATCGGCCGAATTGAAGAAGTATAATTATACAT
AACATAGGGATACGTTCAGGCAATTGTCCACATCCCACACAAATTAAGATCATACCAAGC
CGAAGCAATGAGTTTTTATCAACCATCCCTATCTCTTTATGACGTTTTGAACGCATTATC
CAACCAAACTGGCCAGAGAGGGCAGCAAGGATATCCTCGCCAACCACAAAGGCCACAGAG
ATACCATCCCCATTATGGACAAGTGCACGTTGGCGGGCATCATCCTCGTCATCATCCATT
GTATAGCAGATACAATGGTGTTCCTAATACCTATTACTACCAGTTCCCTGGACAAGCCTA
TTACTATAGTCCTGAATACGGTTATGATGACGAGGATGGTGAAGAAGAGGACCAAGACGA
AGATATGGTGGGTGACAGCGGCACTACAAGACAGGAAGATGGTGGCGAGGACAGCAACTC
GAGAAGATATCCATCATACTACCATTGTAATACTGCCAGGAATAATAGGACCAACCAACA
GGCAAACAGTTTAAACGACTTATTAACCGCGTTAATAGGTGTTCCACCATATGAAGGCAC
TGAACCAGAAATTGAAACAAATACCGAGCANGAGGGGCAAAAGGGGAGAAGAAAGGAANN
GNANGGATAAGTCTGANNNACCCNAAAGANGAAACTGGGNGAAACCCANCANACAANNCC
CTTTGAATNCANCGGGAGGAATCGGTGAGAACAACCATTTGACCANAAAATCTTCATCNT
TNGGNTAAANNAAAAACGCNATCCCCGATACGTGAACCGGTACAAGGATNCAACCGTGAA
ANCAAAACACCACGNNCCANNTCACGCTNNAGGAAG
Quality >S03036-02_B18.phd
5 3 3 5 3 4 6 5 5 3 4 16 13 5 7 5 8
27 19 20 8 8 26 16 12 17 11 8 15 40 36 40 23 34
31 42 41 17 32 31 28 14 12 17 23 24 20 16 22 17 28
30 41 52 28 35 51 30 43 41 49 49 30 42 42 42 35 39
35 18 19 31 35 36 42 37 32 21 30 35 35 24 28 32 43
43 35 42 34 21 39 23 32 37 33 28 36 39 44 47 44 44
42 47 47 44 35 44 58 44 47 42 60 60 47 42 44 46 57
57 57 60 52 57 47 57 47 47 52 60 52 60 60 63 60 43
45 57 63 63 57 57 57 52 52 57 60 57 57 52 57 60 60
57 57 60 60 52 60 52 60 52 52 57 57 63 63 60 60 52
57 52 52 60 63 63 63 63 63 63 63 54 58 60 63 52 63
63 63 58 63 63 57 52 57 52 52 52 52 52 60 52 52 57
60 57 57 60 57 58 48 52 57 52 60 60 52 57 52 47 42
28 47 27 29 39 52 42 47 60 52 63 58 52 60 58 57 52
54 52 48 52 52 52 52 52 60 60 43 60 52 47 57 63 60
58 63 63 52 57 63 63 63 63 63 63 63 58 63 63 63 63
63 58 63 63 63 57 57 58 63 60 58 58 60 57 60 57 57
57 60 57 59 59 57 57 52 57 57 63 63 60 63 60 52 57
60 57 57 58 46 58 60 52 60 57 63 52 52 63 57 57 58
57 57 50 60 60 60 59 54 60 60 57 52 60 54 50 54 54
50 50 49 60 49 60 60 49 50 57 60 44 49 60 49 60 58
63 63 60 49 58 60 58 58 49 57 59 60 44 43 60 60 60
54 50 49 49 50 60 57 54 50 60 47 63 50 44 60 50 44
49 49 50 63 44 32 63 58 50 60 50 54 59 50 47 49 54
54 60 44 44 54 47 60 49 45 47 54 49 49 60 45 44 47
42 60 49 49 49 46 45 44 54 42 27 46 32 50 59 59 54
39 42 50 50 54 28 59 50 44 50 42 42 49 35 42 27 44
38 54 54 50 50 44 42 49 50 42 50 44 39 36 44 42 44
50 46 50 42 33 49 49 54 54 42 54 31 42 39 39 42 36
49 38 36 39 33 35 42 36 36 36 28 32 57 39 46 42 50
54 44 44 39 49 39 49 35 54 54 42 54 31 44 42 44 38
27 49 42 27 50 42 43 42 42 32 41 44 31 38 46 33 37
50 34 32 30 30 42 54 50 42 42 44 35 30 38 37 30 33
30 27 29 31 50 20 27 20 24 22 16 25 20 30 30 34 22
33 34 42 30 19 31 29 22 31 30 18 13 10 19 21 18 16
42 42 15 12 12 19 26 10 12 12 10 15 14 17 21 21 15
27 27 11 15 8 10 11 27 27 28 12 18 27 13 13 16 11
13 6 20 16 9 27 15 9 10 9 24 29 29 15 30 19 11
18 19 33 32 16 35 32 25 10 17 9 11 6 6 8 7 11
6 11 17 26 14 22 22 25 25 19 22 14 26 6 6 7 10
11 12 10 7 8 10 22 16 20 7 10 18 10 11 17 16 13
14 13 6 9 31 11 15 14 15 13 20 6 11 12 6 12 11
11 27 7 7 9 17 12 10 12 15 18 13 14 12 6 9 11
7 13 13 33 17 15 11 26 14 15 19 13 16 15 9 10 14
14 16 17 14 10 8 10 17 11 12 10 10 10 9 14 12 16
7 19 14 19 19 22 14 17 14 12 13 14 11 6 9 18 7
15 21 6 20 28 12 14 6 6 11 9 10 18 12 9 21 13
7 9 11 13 16 15 25 17 16 11 14 17 15 23 20 19 10
13 14 14 17 15 8 8 29 8 11 11 17 11 7 11 12 20
12 17 14 11 14 15 29 30 7 13 23 13 18 13 10 8 11
10 10 17 11 7 7 15 12 9 7 7 8 12 17 9 8 8
12 6 6 9 12 22 13 13 12