S03036-02_B19
Seqid S03036-02_B19
Sequence >S03036-02_B19.phd
NNNNNNNNNGGNGNNTTGNNGGCCAAATCGGCCGAATTGAAACCAGGTTTGTTTTGGCTT
TTATTTGCATTTAAGTAATTACAATTACAACCATTAAAAAGAAAATAAGGCAAAACATAT
AGCAATATAATACTATTTACGAAGATGTCAGCGATATTATCAACAACTAGCAAAAGTTTC
TTATCAAGGGGCTCCACAAGACAATGTCAAAATATGCAAAAGGCTCTTTTTGCACTATTG
AATGCTCGCCACTATAGTAGCGCCTCCGAACAAACGTTGAAGGAGAGATTTGCTGAAATT
ATCCCAGCAAAGGCAGAAGAAATTAAAAAATTCAAGAAAGAACACGGTAAAACCGTTATT
GGTGAAGTTCTTTTGGAGCAAGCTTATGGTGGTATGAGAGGTATTAAAGGCCTTGTTTGG
GAAGGTTCCGTGTTAGACCCCGAAGAAGGTATTAGATTTAGGGGTCGTACTATTCCAGAA
ATTCAAAGGGAACTACCAAAGGCTGAGGNTAAGTACAGAACCTTTGCCAGAAGCTTTATT
NNANGTTGCTTTANAANGGNNAAAGAACCTACTGNCGCTCAAGTNAAAACCATTTCTGCT
GATTTAACCGCCNGATGAAAANTTCGAGAANNCGGNCTTCGACTTTTATNAAGGCTCCCC
AAGACAAAATCTGAAGCGGAGTAAGATNANGCCGTNNCCATTNAANGGATNANCTANANA
NGGAAGCAANNNTCACAGTGAAANNGNGGGACTAAAANANNNGGGTAGAGAGCAAGCNAG
CACGATTTCGTTGTTNTAAGTTNGCGAAAAGAANGGNCATNCTANNATTCCCTGCGNCAT
CACCCCGGAAGTNGAGAGGAGGCATGGTACNCATGN
Quality >S03036-02_B19.phd
4 3 3 2 3 4 3 4 5 12 17 5 8 5 5 10 8
15 5 6 20 14 26 30 12 14 25 35 47 43 20 41 47 47
39 16 25 36 32 17 29 32 41 30 16 50 43 37 51 52 35
24 52 51 51 52 26 38 50 49 49 38 49 44 49 50 42 50
46 44 49 50 49 50 50 52 46 46 42 47 52 49 28 49 49
43 54 50 33 46 49 39 44 59 54 59 54 54 50 50 59 54
50 49 41 43 54 49 46 42 50 54 49 46 47 54 59 59 59
59 57 57 57 57 54 57 49 51 54 54 50 54 54 50 57 57
57 51 50 57 54 54 49 43 42 54 57 57 57 57 57 57 51
53 51 57 57 57 59 57 57 57 59 57 54 54 57 51 34 43
52 59 59 59 57 53 53 53 53 57 53 51 57 59 54 54 57
57 57 57 57 54 57 59 57 54 54 59 57 51 42 57 54 57
57 57 57 57 54 59 54 50 54 54 50 50 54 49 49 49 42
45 57 33 54 54 54 57 59 59 59 57 59 59 57 52 57 57
53 57 57 57 57 57 57 59 59 54 57 57 59 54 57 59 59
57 57 54 57 59 59 57 54 57 57 51 53 54 57 59 59 54
54 54 54 54 57 54 50 51 49 47 54 51 42 57 42 30 23
53 54 50 45 49 57 57 53 51 42 51 54 59 59 57 50 43
49 57 43 57 57 50 54 59 59 59 57 49 46 57 51 49 33
54 54 54 54 59 57 47 43 53 50 35 50 57 57 51 51 49
51 49 49 54 54 54 57 54 57 57 49 45 35 49 50 49 50
49 43 49 46 43 41 54 54 53 36 54 54 54 51 49 47 49
49 49 49 43 54 46 49 49 42 54 54 54 50 50 50 42 49
46 39 50 36 54 50 42 49 35 50 35 32 27 49 31 35 30
45 46 33 49 50 49 49 46 49 49 46 41 34 31 43 31 49
35 46 40 41 46 46 46 32 37 31 35 50 42 43 35 29 27
32 37 28 40 43 33 40 20 39 28 35 39 39 42 20 20 18
36 28 30 27 27 17 28 32 27 39 27 39 42 34 46 20 8
21 16 21 20 37 29 20 30 19 39 42 42 30 27 35 42 35
35 18 28 12 12 21 40 42 35 23 22 24 24 9 11 7 8
22 11 16 9 21 19 20 18 50 47 19 27 24 35 11 8 10
11 15 9 22 27 17 27 35 37 35 28 35 13 7 6 8 7
14 16 19 26 33 16 18 10 9 5 9 9 6 17 22 7 7
11 14 14 9 10 19 13 18 16 32 14 23 12 7 12 13 25
22 10 12 35 10 10 6 16 23 11 9 20 18 10 13 16 18
9 19 24 9 10 13 16 10 9 9 24 17 9 16 13 12 9
6 11 19 11 11 9 9 26 16 6 9 15 14 10 26 8 32
10 6 6 11 10 10 6 11 14 10 10 9 10 20 28 28 18
24 10 9 6 8 11 24 11 18 13 10 11 9 8 19 10 11
12 11 10 24 10 14 23 11 8 11 9 9 14 9 11 9 13
9 9 10 11 16 11 9 7 23 6 15 14 11 11 8 6 6
20 8 9 11 11 7 10 11 7 10 11 9 9 7 11 7 16
9 9 6 9 7 11 7 10 9 31 10 11 9 14 12 7 6
6 10 11 10 16 18 8 11 13 11 11 10 6 6 9 6 8
9 15 18 9 12 10 14 10 9 6 9 7 6 6 10 11 9
10 12 14 9 11 12 10 9 11 8 14 11 6 18 9 9 9
10 9 11 14 8 16 9 9 9 13 11 10 8 6 10 9 8
9 14 11 6 9 8 10 12 13 18 30 9 24 9 6 8 9
6 9 11 9 7 10 11 11 6 6 10 9 9 16 14 12 8
11 9 8 6 9 9 9 12 10 9 9 10 9 10 22 14 14
18 9 6 13 10 21 8 16 14 9 18 9 9 9 9 9 9
11 12 9 6 8 11 11 9 6