S03036-02_B21
Seqid S03036-02_B21
Sequence >S03036-02_B21.phd
NNNTNNTTTNNNNNCGCGNNNAGGGCGATTGGCGGCCAAATCGGCCGAATTTTTTTTTTT
TTTGGGGTTTTATTTAGGTCGGATTATTTATAAAGATAGCATTTATATACATTTTTACGC
AATTACCCTCATATTCTTACACATACGGAGAAGTCATTGTTATATTTTCTTGCCTCAACA
TTGTTATCGGTGATTTTCTTTCTTTATTGATTGATTAGTTATATAAATTATTGCTATTAA
AATACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAGTTCCCGGCCATAAGGGCCAGCTTGGTTTTTCTATAGNGGCACCAAAA
NGGTTTGGCGTAATCTGGTTCTTAGCTGTTTCCTGNGAAAAAATGTTATCCGCTCACATT
TCCCCCCAACATAGAAGCGGANAGAAAAAAGTGTAAANNCCTGGGCNNCNCTANGGGNGG
AGGAGAATAGAAATAAAATTGCTTTGCNCTCTNTTNCNCCTCTTACCNGNAGAGAAACAA
CGAGGAAGAGGAGGNNNGCCNACCNGCGCCNNCCANCGAGNTGAGGGAGAGAGGANACTA
TATTCNCTTTTTTATTTTTTGATTGANNGAAAAAGATAAGAGGTAAGCTGAAGGTGCGTA
TCTTTAGTTTTTTGCTGNTNGTAGGNGGAAAGAGAGGGGGAAGCTTTTATTTTGTTTTTT
TTTTTAGGGGTANNTAAAAAAAAAGGGTGTCGCACGGNCTTGGNTTANGANATGGNAACC
CAAAAAATAAAAAGAAGNACACCCACCCCTCACCAAAAANATNTNGGANANGGAGGTT
Quality >S03036-02_B21.phd
4 3 5 8 6 7 9 8 8 7 5 3 5 7 8 8 8
8 5 3 3 8 9 13 15 9 24 23 18 27 31 11 13 36
20 11 19 14 13 26 40 50 49 28 46 43 49 31 17 31 49
49 49 49 49 52 46 35 35 35 46 54 35 35 35 43 30 25
39 37 23 43 38 46 34 44 46 42 42 44 54 50 44 19 42
60 44 60 44 44 42 42 46 46 44 48 26 40 42 42 39 40
60 42 47 47 46 46 47 52 46 52 60 57 52 52 57 48 42
57 57 57 43 48 57 52 60 57 57 52 52 52 57 54 57 60
52 52 60 57 52 52 52 57 57 59 57 57 48 48 58 57 52
57 57 57 52 57 57 60 52 57 57 52 54 60 63 57 57 60
57 57 57 57 52 57 58 57 57 54 59 59 63 60 52 58 63
54 60 52 57 52 48 52 60 63 57 52 60 60 54 57 60 60
52 57 52 60 60 54 52 60 60 52 52 52 52 59 60 52 60
59 59 60 60 60 40 40 35 40 35 40 52 42 32 43 47 52
57 57 57 60 57 57 57 44 46 60 57 60 57 60 60 60 47
60 42 47 60 60 47 47 42 42 60 49 47 47 60 50 47 60
60 50 43 43 46 50 46 42 34 39 35 39 31 31 27 35 39
42 39 39 33 35 35 27 24 25 33 26 37 30 34 23 20 25
19 30 34 34 22 19 8 12 15 18 23 14 22 17 26 12 11
11 15 10 54 27 15 19 21 9 12 12 21 12 15 10 9 21
27 22 19 20 21 15 15 12 15 7 29 10 12 12 18 12 18
33 33 12 7 10 12 11 19 14 22 24 16 12 11 19 23 24
26 8 11 14 11 14 11 9 12 12 10 18 17 15 36 40 19
33 16 10 17 6 12 13 17 34 49 34 9 16 12 21 16 18
16 19 19 16 24 15 17 9 15 20 13 21 32 35 26 19 27
11 16 24 17 18 10 16 14 11 10 16 12 16 9 18 13 7
25 20 17 15 20 31 30 18 10 9 17 10 29 16 11 6 7
17 10 9 16 11 11 8 6 7 24 6 9 9 12 7 17 13
14 6 12 13 8 31 12 15 9 17 10 10 10 8 16 31 14
19 15 21 19 16 24 19 15 20 30 49 25 10 16 7 11 14
10 8 7 14 21 6 9 7 11 14 8 15 19 16 8 11 9
6 9 7 8 10 13 9 17 51 21 9 8 8 12 8 19 18
10 31 29 9 44 18 13 17 13 10 6 5 5 12 25 10 6
10 8 9 7 9 11 10 13 9 7 7 14 11 9 7 9 8
8 8 6 12 23 11 14 10 11 14 10 11 14 14 9 9 11
6 9 10 11 8 11 15 16 11 11 7 9 18 26 26 22 23
17 11 14 47 53 47 32 11 8 10 13 20 10 11 6 7 9
14 20 33 8 11 12 34 16 27 28 9 28 17 12 9 11 15
16 9 23 18 16 40 10 14 11 13 11 16 19 11 18 14 12
23 9 9 10 10 28 15 11 8 10 18 15 10 11 6 9 6
8 11 9 8 11 7 16 19 15 9 9 32 11 10 9 11 14
18 14 22 19 19 15 17 8 9 22 11 14 15 14 12 9 16
18 14 11 14 10 25 23 19 11 14 14 8 10 15 15 15 14
11 6 6 9 18 11 14 32 18 15 11 11 15 11 11 11 10
9 9 9 22 12 15 23 10 10 6 10 10 10 11 10 7 8
10 8 6 9 20 7 11 10 8 11 6 10 10 11 8 10 15
14 10 22 18 14 9 8 28 32 15 14 10 15 22 11 6 14
11 9 10 14 13 11 11 14 15 11 12 14 11 10 13 10 10
10 11 19 7 9 10 7 8 6 10 9 8 6 11 7 9 11
11 11 14 8 14