S03036-02_B24
Seqid S03036-02_B24
Sequence >S03036-02_B24.phd
NNNNNNNNNNNNNNNNNNNNGCCCCGNNNNNNNNGGCGATTGGCGGCCAAATCGGCCGAA
TTGAGGGAAGTAATTGGATTGGGAGAATCTAAAAAATGTGGAACTCACTAAAAGCATTCG
CTCTAGTGTTCGGAGGTTGTTGCTCCAATGTTATTACATTTGAAACCTTAATGAGCAACG
AAACAGGCAGCATTAATAATCTCATTACTTTTTGTCAATTTTTATTTGTTACATGTCAGG
GACTCCCCGAATTTCTGGATGTTCATCAACCTTTCCCTTACTTCAAGCCTCTGAAAACTC
CACTTCACGTTTATGTCATTACTGTCGTTTTATTTTATATTTCATCTACGACGAATAATA
ACGTATTTAAATACAACATATCCATTCCGATTCATATCGTTTTCAGATGCTTCGGAACCG
TAATAACCATGTTTACATGCTGGTTATTAAATGGTAGGAAATATACGAAGATTCAGATTT
TATCAACACTATTTTTAACCATTGGAGCTATAATTGCCTCATTATTCAGAGATGCTGATT
TTCGGTACCAAAGATTTGAAACTGCNANCGTGGANGATTGGAAGTGACCAATCTGTCGAT
CTNNCNTNGGGGTGGGGGGGGGNGGGNCTAGTACTTANATTATTGGCANCNTCNTTACNT
TCAGNATACGAAGGNGTAGGNNGTCAGANNGANGNNAGAATTGNAAGGAGAATAACAGTN
CTCCCCTCCCCCGCNNGTTGGGNGGGGAGGAGNGGTNGAATATTTTTTTTTTATGTTTTG
GTGANTAAGGGGCAGCGGGGGGGGGGGGGGNGGAGGCNGNAANGANANANNAAAATAAGA
AGAGACNAGCNCCC
Quality >S03036-02_B24.phd
5 2 3 3 3 4 3 6 7 5 6 4 5 6 5 3 3
3 5 3 9 8 10 23 16 11 7 3 5 5 7 5 7 6
13 21 11 26 31 15 37 32 19 25 34 19 13 24 11 17 24
34 31 40 28 22 35 35 25 16 43 26 19 12 12 33 34 27
25 36 20 32 28 30 51 49 35 27 19 41 46 31 37 38 32
42 30 26 46 35 35 35 35 50 49 40 32 41 38 43 42 34
35 38 54 43 42 44 44 44 39 39 38 39 39 35 30 42 50
39 34 44 43 44 42 47 50 58 49 49 50 50 50 45 44 50
49 63 60 58 60 50 45 47 54 42 44 50 50 63 60 50 49
50 50 54 58 50 63 60 49 52 58 63 63 63 63 60 50 49
60 50 57 58 57 54 60 54 50 54 54 60 50 60 50 54 63
49 60 49 54 60 50 63 63 63 63 63 63 63 63 63 63 58
63 63 63 63 63 63 60 51 60 63 54 54 54 54 54 60 60
60 50 54 50 60 60 58 54 50 60 60 50 60 50 47 35 40
47 63 50 44 33 32 38 23 25 38 47 50 49 49 60 58 63
63 63 63 63 52 63 63 63 58 59 58 58 54 60 57 60 60
60 63 63 63 51 60 57 58 51 63 54 54 54 54 63 63 60
54 59 54 54 50 60 60 54 57 54 60 52 59 50 60 60 50
60 54 60 63 63 50 54 50 63 58 51 51 58 63 60 58 57
63 60 60 60 60 51 60 50 60 50 49 49 47 54 60 60 54
60 60 47 42 47 60 40 35 47 44 47 47 42 47 47 42 42
32 35 35 33 35 42 39 42 47 42 42 44 60 60 60 50 57
47 52 52 60 60 57 60 60 52 47 52 57 60 47 47 52 52
57 52 46 60 57 57 60 57 57 57 60 60 52 52 57 54 46
60 60 57 59 57 52 63 41 40 52 57 60 47 35 44 47 57
60 46 35 40 60 60 57 46 41 57 60 52 46 60 47 52 43
41 52 47 47 42 44 44 57 60 46 60 52 35 46 32 60 15
21 23 24 27 18 18 18 9 21 11 18 32 34 34 47 35 30
43 47 42 35 23 18 28 28 25 26 19 14 11 15 17 16 16
17 22 27 29 32 30 52 46 46 34 43 42 57 41 60 47 24
35 28 26 40 43 42 42 42 35 20 28 46 60 52 41 35 28
13 8 12 34 47 22 20 21 20 30 31 17 40 21 16 21 16
23 26 28 23 24 17 26 18 16 48 47 40 32 29 14 12 29
41 41 42 9 5 10 7 18 9 14 15 8 13 7 8 11 13
16 22 19 29 30 13 19 18 23 10 15 10 21 16 14 11 12
9 10 10 16 12 18 9 7 6 12 7 9 6 11 9 10 9
9 16 11 29 28 20 22 11 11 12 6 10 11 9 6 18 12
16 28 16 12 17 19 13 9 7 10 11 11 13 22 19 9 9
12 9 6 12 7 17 16 7 18 12 25 10 6 9 9 13 15
12 6 20 19 12 9 10 20 11 10 10 6 16 9 17 9 11
6 7 9 10 9 12 9 19 6 7 9 9 6 9 7 6 8
15 9 17 11 11 12 7 24 20 19 27 28 10 27 22 12 17
9 9 9 10 10 6 22 9 14 14 13 9 9 9 9 9 16
9 27 11 7 7 21 10 10 14 14 19 7 11 27 39 8 11
13 10 12 9 7 10 10 9 7 11 14 8 10 22 10 28 15
11 12 14 23 19 29 12 10 13 11 18 11 9 11 14 19 13
11 9 6 13 22 13 17 28 31 10 10 12 19 11 31 17 20
11 17 15 21 21 16 14 19 12 18 12 6 14 11 10 11 8
16 6 10 6 9 9 7 8 19 7 26 7 12 7 7 9 39
13 39 9 35 16 14 22 16 18 26 16 16 12 7 10 12 9
7 9 12 12