S03036-02_C02
Seqid S03036-02_C02
Sequence >S03036-02_C02.phd
NNNNNNNNNNNNTTNNNTNGGCCCTNNCNNNNNGNNGATTGNGCGGCCAAATCGGCCGAA
TTGAAGAAGTAGAATAAACAAAACAAGAACATTAGGAATAGTGGGTACAGCTATAGCAGT
GTTGGTCACATCCTACTATATATATCAAAAGGTGACAAGTGCAAAGGAAGATAATGGGGC
ACGACCTCCAGAGGGTGATTCAGTAAAAGAGAACAAAAAGGCAAGGAAGAGCAAATGTAT
TATAATGAGCAAGTCGATACAAGGACTGCCCATAAAGTGGGAGGAGTACGCCGCTGATGA
AGTGGTTTTGCTGGTACCTACGAGCCACACTGATGGATCAATGAAACAAGCCATTGAGGA
TGCCTTTCGCAAGACGAAAAACGAACACAAAATCATATACTGCGATAGCATGGATGGATT
ATGGTCTTGTGTAAAACGGCTAGGTAAATTTCAGTGCATATTAAACTCCAGGGACTTCAC
AAGTAGTGGTGGTAGCGATGCGGCAGTTGTTCCTGAAGATATAGGCAGGTTTGTCAAATT
TGTTGTTGATAGCGATATAGAGGATGTGCTGATTGACACTTTATGCAATTAATGTAGAAA
AGAGTTTCTTGTAACAGTATGTAAAGAATAAATAATTATAAGTATAAATAANAAGAGAAG
GTGNNNTAATNANNAANANANGANANANAAGAGAANNNNAAAAAAAGNAAGAAAGTNCNN
NNCNTNNNNNCAGCTNNAGTNTNCNANNGNGNCNCNNNNNANGNNNNNGTATCTGGTNTN
NNANNTTNCNNNNGAAATTNTTATCCCTCNNANNTCNCAANAGNNNNANNNNANANANNN
GAAAGCCNGNNTNNCNANNAATGANGCACANACANANATNNCTTC
Quality >S03036-02_C02.phd
5 3 3 3 4 6 4 3 3 3 3 7 12 9 3 5 5
12 6 21 18 8 10 11 9 5 3 8 5 6 5 7 7 10
6 7 20 20 12 41 19 6 13 10 32 20 16 26 9 23 21
35 35 33 22 40 41 41 29 13 35 31 28 13 12 25 30 32
41 46 36 30 30 32 38 41 36 37 41 46 46 51 49 41 43
43 49 43 43 49 41 42 43 42 38 54 41 54 42 35 35 36
43 32 34 43 38 41 33 42 42 35 35 59 50 54 54 54 54
54 50 46 49 50 42 49 54 54 50 50 57 57 57 51 51 52
57 52 57 57 57 59 57 49 54 44 50 50 59 59 50 45 49
59 41 44 50 51 53 57 57 59 51 53 51 57 57 57 57 57
42 43 54 59 57 57 57 53 42 57 42 42 59 57 52 53 53
57 57 59 54 57 51 59 57 57 57 42 35 53 43 51 59 57
57 57 57 57 57 57 57 57 50 51 54 54 59 57 57 57 57
54 57 57 57 57 57 57 57 57 51 51 57 54 57 57 51 49
54 50 50 54 54 50 41 31 49 49 49 54 54 50 54 57 57
51 50 54 54 57 54 57 57 59 44 42 57 57 57 53 51 51
53 50 57 53 53 54 57 59 59 57 54 57 57 54 59 38 42
50 57 57 57 57 57 57 57 43 53 57 59 59 54 57 52 54
57 53 53 42 42 57 59 52 54 54 50 53 52 59 57 49 57
54 57 57 54 59 54 57 59 57 57 52 59 59 41 34 59 59
59 59 59 59 59 59 54 43 49 54 54 50 46 54 59 59 52
49 57 41 32 42 42 57 59 57 51 51 51 54 54 57 54 54
47 59 59 59 57 57 57 38 57 54 57 54 54 59 43 49 46
46 49 49 34 49 49 54 54 57 57 59 59 59 50 43 49 49
54 54 54 59 59 42 33 57 57 35 28 54 50 42 53 51 32
54 54 57 57 37 54 46 49 53 53 49 42 54 54 54 49 54
54 57 43 46 57 54 35 53 51 35 34 47 54 54 37 43 49
46 43 49 49 46 46 49 49 49 46 34 32 42 23 21 30 37
46 40 35 49 26 49 49 54 38 49 46 47 45 28 49 49 30
54 46 43 46 42 28 35 43 35 49 46 37 49 49 53 42 39
42 31 39 41 35 23 30 31 43 28 33 32 36 35 52 43 35
46 49 35 49 39 42 29 46 26 15 31 28 42 42 34 37 42
39 28 42 42 35 30 43 31 42 32 42 28 35 41 28 31 29
46 46 32 18 42 30 31 28 30 36 28 35 40 46 36 32 32
37 39 31 37 30 31 47 36 26 27 28 35 21 31 34 50 25
41 41 36 37 36 36 32 42 30 29 15 35 39 13 15 15 9
17 19 42 15 27 26 19 34 42 27 27 31 23 29 23 46 32
15 50 31 29 34 37 30 45 21 45 19 32 29 36 10 21 14
20 32 31 14 13 5 17 30 31 35 25 27 13 13 36 19 11
7 3 5 10 18 10 9 6 9 5 6 15 9 6 9 7 15
6 19 9 5 9 6 8 5 10 8 8 13 9 10 9 6 6
5 5 10 11 11 17 20 20 14 11 6 14 15 10 16 19 23
23 12 6 9 5 5 5 5 10 5 8 7 7 7 5 7 8
18 9 10 13 6 7 10 10 10 6 8 6 10 6 11 6 6
9 6 17 5 14 6 8 5 5 7 6 5 16 6 11 5 6
5 5 7 8 10 22 12 15 8 15 21 21 6 9 5 5 6
9 7 3 16 15 6 25 6 6 6 6 13 10 13 19 12 12
7 10 9 25 10 10 9 9 9 14 5 5 9 5 5 8 13
6 9 19 12 3 8 12 6 5 3 5 9 6 7 3 3 8
5 9 6 10 6 5 5 9 16 18 17 9 12 10 6 14 5
6 9 6 7 10 6 9 6 6 8 9 9 12 12 6 13 9
26 13 11 6 12 9 15 6 9 6 10 9 6 6 9 26 12
11