S03036-02_C03
Seqid S03036-02_C03
Sequence >S03036-02_C03.phd
NNNNNTNNNTNNNNNNNGNNNNNANNNNNGGGCGATTGGCGGCCAAATCGGCCGAATTGA
AGTCACCAACTACAATAAATTACATTATACTATAACATGTCATCTGCTCTATACAAACAA
AACACAAATTTTACTCATTCTACCGGTTCTTTCTTGCAAAGCGCACCTGTTGAACTGACG
ACAGTCAGTGGGTACCAGGAGTTTTTGAAGAAGCAAGAGAAAAAGAACTATGAAATTCAA
ACAGTTTTAAGCGAGGATAAATCACATGGTTATGTGCTAAAGGACGGCGAAGTCATCGCT
AATATCATTGGTGAGGCCAAAGATTATCTTTTGGATTTGGCCGGCCAGGCTTGAACGAGT
GGCTAAATATTTGTTCGATACGAGTCACTTCATGCACACTTTGATTTGCACTCTTATTGC
TGGGCTGTAGTTTTCTTTTCCGTTTTCGCTTATAAATCTAACATGTTCTATTAGGGGAAA
GAAAGGCGCAAATTGTAGAGTTTGTTAGGTCTTTTAAGTACTTGATTTCACCAACCGAAA
GTGAAAGAAATAAAAAAAGATAAAGCTATTATTATTACCATGACCCTGTCATTGGTTTAA
AACGTTTGTCCGTCTGCTTTTGNTGTNTTTAANAAAATTTNAATAAATATTCTAAATAAG
TGAATTAGAGGCTGCNAGATAGTTCGTATACGTNNAGGTNNNNCATTNATTNAGNNNNNC
CACTACTANANACAAAAACAANGGAGATANAAAAAGANAGGTNNCGGCTAAANNNNCCAG
NANGNNANNCTTANTGTCNCTAANNAGCTGGNGNNNACGGNCAANAATTTTCNGANNNNN
NNTAANANAANAAANNNANAAAGNAAANAGGGGANNNANANTNNNAANNNNN
Quality >S03036-02_C03.phd
7 5 3 2 5 8 7 6 6 8 6 3 7 7 7 3 5
13 7 3 3 3 5 8 3 5 3 5 5 9 21 20 8 27
24 13 35 29 12 11 35 24 26 26 16 14 28 31 36 42 29
38 28 35 32 16 41 49 31 15 16 29 34 33 19 30 41 33
46 50 43 30 42 32 50 42 51 49 49 42 43 52 42 42 42
33 31 32 33 36 42 42 42 43 43 42 33 36 40 35 35 38
54 54 43 50 50 42 50 38 42 42 42 54 42 46 54 52 50
54 49 45 50 59 54 50 54 54 49 43 47 44 54 44 54 44
38 49 49 49 44 50 50 54 50 50 54 50 50 54 54 54 54
50 57 57 54 50 50 57 57 57 44 54 50 50 51 45 47 51
47 53 51 51 51 57 51 45 42 49 51 50 51 53 51 53 51
54 59 57 51 53 57 50 42 53 53 53 53 42 53 53 53 53
53 53 51 51 52 54 53 51 54 54 54 54 57 57 57 57 53
57 57 57 54 57 57 51 51 57 57 49 50 46 45 50 50 49
46 40 46 46 46 54 54 54 49 50 51 53 53 57 52 57 54
50 44 44 49 50 49 51 59 59 59 59 57 53 51 54 57 54
50 57 57 57 57 54 54 51 51 57 57 42 38 57 57 50 57
53 57 50 51 53 54 54 57 57 54 57 50 57 54 54 54 50
59 54 57 59 57 59 57 53 50 50 33 57 42 57 57 54 57
38 49 49 38 57 54 57 57 57 57 53 50 33 59 54 50 41
44 57 50 50 33 52 42 50 51 46 54 54 57 54 50 50 54
54 54 54 57 50 42 57 43 51 49 54 54 50 57 53 57 50
54 57 54 54 43 54 50 50 57 50 51 49 50 50 51 51 50
49 49 54 54 54 54 50 54 57 54 54 54 42 35 46 49 57
50 52 42 54 54 59 57 54 44 59 57 42 49 51 53 49 38
57 57 50 46 42 50 53 53 51 49 54 57 51 50 43 50 42
35 46 51 50 50 50 52 54 49 43 46 42 43 46 42 50 43
32 49 46 46 46 49 27 46 49 42 50 47 49 43 30 42 40
49 39 33 42 40 49 49 54 42 53 21 35 28 30 30 38 35
40 47 30 43 35 46 50 42 42 34 42 33 40 46 42 45 26
49 40 37 31 31 28 30 36 49 30 46 54 49 39 34 28 41
39 40 24 39 49 26 45 39 49 43 42 27 37 35 32 46 33
30 40 50 39 23 41 18 9 12 20 39 43 54 54 42 46 28
15 39 40 42 37 39 33 35 39 36 23 46 31 27 35 39 20
21 29 35 31 28 35 27 29 42 43 42 24 19 39 50 39 35
14 17 20 23 31 32 28 16 9 19 32 34 35 24 19 20 18
20 26 23 24 14 21 19 26 17 11 6 9 21 9 6 9 10
21 19 12 7 21 29 13 8 17 23 15 6 8 8 35 19 42
19 19 15 23 23 20 19 10 17 14 12 22 34 19 21 37 29
15 24 44 44 27 39 27 35 29 27 11 8 5 19 21 34 18
18 16 12 29 27 32 27 26 16 11 28 20 28 6 6 8 9
8 10 5 5 7 7 17 19 14 11 6 10 8 12 5 15 15
5 6 6 6 7 10 10 11 9 8 12 8 10 9 6 15 7
11 15 18 10 16 10 15 10 16 8 6 12 11 13 12 26 12
15 6 11 9 10 14 10 8 12 7 17 16 17 10 7 6 9
13 10 11 8 10 9 9 6 6 6 6 18 19 12 10 6 9
6 10 5 5 9 5 7 12 9 9 8 6 11 21 9 9 5
9 12 10 11 5 7 8 15 9 9 8 12 7 15 5 5 7
10 9 16 12 6 9 15 11 6 8 16 9 10 14 9 9 7
9 12 7 6 5 5 6 6 6 10 9 9 6 11 7 9 9
6 9 16 18 7 7 6 12 6 10 13 8 9 7 11 25 9
7 16 11 13 18 9 10 6 7 7 9 6 9 6 9 6 6
6 10 16 7 7 6 6 5