S03036-02_C04
Seqid S03036-02_C04
Sequence >S03036-02_C04.phd
NNNNNNNNNNNNNGNNCNGNCNNNNNNNNTAGNGGCGATTGGCGGCCAAATCGGCCGAAT
TGGAGATACTATAAACTACAGCTTAGCTAACTCTAACATTATTATATAAAACAATGGGCT
TCAATATAGCGATGCTGTGCGACTTTTTTTATCCACAGTTAGGTGGAGTCGAATTCCATA
TATATCATTTATCGCAGAAACTAATCGATTTGGGCCATTCTGTCGTCATTATAACTCACG
CTTACAAAGATCGAGTCGGCGTACGACATCTTACCAACGGTCTAAAGGTCTATCACGTAC
CATTTTTTGTGATTTTCAGAGAAACCACTTTCCCCACTGTTTTTTCAACATTTCCAATAA
TAAGGAATATTCTTCTCAGAGAGCAGATCCAAATTGTTCATTCTCATGGTAGTGCTTCCA
CGTTCGCTCACGAGGGAATTCTTCATGCTAATACTATGGGATTGAGAACTGTGTTCACGG
ACCATTCACTCTACGGTTTTAATAACTTAACGTCGATTTGGGTGAATAAGTTGCTAACAT
TTACCTTGACAAACATAGATCGGGTTATATGTGTTTCTNANACATGCAAAGAAAATATGA
TTGTNAGAACANAATTAAGTCNTGATATAATCTCAGTAATTCCCAACGCANTGNTGAGCG
AAGATTTCAAACCAAGGGATCCTACTGGTGGCACCAAGAGAAACNAAAGTANGGATAAGA
AAGAGATNGNNNNNCACNNGGAAGGCNNGNNNCAAANNAAGGNNNGAANTTCATANTCAC
ANNANNAGAAANNTTGTNNNTCACATGNAGGTGCGGAATTTNNTGAAGTNNNNGNNANTC
CANNNANNNANAANTNNTNNNNNNANGNANANNAAAGTNCGAGANAGAATGNAAAANTNA
NNNGNGGAG
Quality >S03036-02_C04.phd
4 3 3 3 3 3 5 6 6 4 4 6 6 8 5 6 9
5 8 7 9 7 7 3 5 5 5 5 7 10 12 12 6 18
24 8 27 27 14 33 31 14 11 40 24 16 26 24 20 31 47
41 48 25 35 35 42 34 18 41 40 40 29 32 36 17 17 17
31 41 43 47 46 49 46 49 35 43 31 42 49 50 51 37 50
49 49 42 35 43 42 52 52 42 46 52 43 30 50 43 49 45
42 54 54 54 59 59 59 54 54 47 42 50 49 49 53 43 45
46 49 57 59 57 54 57 57 57 50 50 50 50 50 50 42 42
43 51 54 50 54 43 42 50 54 50 51 54 57 57 52 59 59
57 44 59 54 57 54 50 51 51 53 57 53 43 47 45 45 45
51 53 53 53 53 54 54 54 54 57 57 57 59 59 57 54 54
57 53 53 53 53 53 57 57 57 57 53 53 51 57 57 50 53
53 53 51 53 51 57 57 53 43 42 50 57 54 51 53 53 57
57 57 57 53 51 57 59 57 53 57 59 59 54 52 54 54 59
54 54 49 49 50 50 50 46 49 54 59 45 50 53 53 57 53
53 53 51 57 50 59 54 54 45 59 57 54 59 57 57 53 53
51 57 57 44 57 57 57 57 57 57 57 54 57 53 53 51 49
53 53 57 51 53 51 53 53 53 54 57 54 54 59 57 57 53
53 53 57 42 57 54 44 53 53 57 54 46 50 53 54 53 53
49 42 51 49 51 53 53 53 51 53 53 52 50 50 54 59 54
51 57 57 57 50 50 35 52 54 50 54 57 54 50 50 42 57
59 54 49 54 54 50 54 57 57 54 31 50 43 57 53 51 53
51 54 54 50 54 57 50 57 54 54 59 54 50 54 54 52 42
50 49 51 53 51 50 51 50 54 50 53 49 49 50 54 54 57
49 50 54 54 59 54 50 54 53 49 49 33 49 49 49 49 49
57 50 50 54 50 50 49 42 33 53 43 53 49 33 57 54 54
49 49 49 49 50 50 38 42 57 49 54 59 54 54 42 59 59
50 38 21 50 54 54 42 54 54 49 46 49 39 54 35 54 54
22 50 50 50 38 33 54 50 43 51 52 42 46 49 54 42 50
46 35 49 24 36 26 26 39 50 42 38 49 49 49 49 33 50
50 49 50 54 42 42 35 49 49 40 45 50 44 42 40 42 28
29 46 35 50 41 42 29 33 42 49 35 33 46 41 35 28 42
49 42 49 50 54 50 27 18 21 27 30 37 33 33 34 18 29
38 42 20 27 25 28 29 30 29 50 42 42 32 33 39 33 10
6 8 7 28 30 18 27 32 26 19 35 49 26 18 28 16 9
17 17 17 22 31 20 27 18 9 7 13 26 22 17 14 10 7
10 19 15 26 19 17 28 9 9 6 9 12 22 16 11 18 19
30 28 39 42 35 27 18 27 27 21 17 29 22 33 32 37 29
20 18 20 18 7 10 16 6 9 24 34 27 32 10 13 26 9
32 27 22 17 20 18 18 12 11 16 18 35 21 21 13 14 24
20 14 13 13 13 25 27 27 22 29 28 13 12 21 29 29 23
21 35 26 20 8 17 16 6 13 13 15 8 21 10 6 17 9
9 8 11 35 14 21 9 20 10 10 16 18 9 6 8 6 7
6 6 7 19 16 9 7 7 9 20 17 32 19 16 10 7 6
9 6 6 7 9 10 12 10 7 6 10 10 9 11 6 6 7
9 21 10 7 11 9 9 9 11 16 6 19 11 13 14 10 7
5 10 6 6 9 9 27 29 17 7 7 9 9 10 9 7 7
7 9 13 14 17 8 20 9 6 14 11 9 13 14 8 9 9
11 9 9 10 8 6 6 12 16 20 15 8 8 6 7 7 6
9 6 7 10 6 9 9 8 8 4 7 6 9 6 7 7 9
6 12 10 7 9 7 7 9 7 6 6 7 7 7 9 7 11
7 9 6 10 6 6 17 10 10 12 9 6 10 27 19 13 10
7 19 19 15 8 10 11 7 16 13 18 16 7 9 7 9 7
7 7 9 7 9 9 11 15