S03036-02_C05
Seqid S03036-02_C05
Sequence >S03036-02_C05.phd
NNNNNNNNNNNNNNNNNNGNNNNNNNNNGGGCGATTGGCGGCCAATCGGCCGAATTCCCA
TGGGGATCCGATATCAAGCTTGGGCCCGGTACCGGCCATAAGGGCCAGCTTGAGTATTCT
ATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTG
TTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGG
TGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTC
GGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTT
GCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCT
GCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGA
TAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGC
CGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAAATCGAC
GCTCAAGTCAGANGTGGCGAAACCCGACAGGACTATAAAAGATACCAGGCGTTTCCCCCT
GGAAAGCTCCCCTCGTGCGCTCTCCTGTTCCGACCCCTGCCGCTTACCGGATACCTGTCC
CGCCTTTCTCCCATTCGGGAAGCGTGGCGCTTTCGAAAGATCACGCTGATAGTTATCTCA
ATTTCGAGGTAGGTATTTCCCTCCAAAGTGGGGCAGTNGGCACAAAACATCCCGGTTTTG
TCCGACCAAGTCTAATTTAACCGAAAACGAAAGCCCCCAATCCAAACACGGANAGAAACT
AGCAAAAGCAACGGTATTAGTCAATTGTAAATA
Quality >S03036-02_C05.phd
7 4 5 5 5 5 4 6 6 5 6 6 6 6 4 3 5
5 8 3 3 5 5 5 5 6 5 7 10 23 30 15 25 29
13 37 35 21 17 40 27 18 20 33 38 47 43 46 29 40 48
41 31 27 35 50 37 34 36 17 41 52 49 49 49 17 16 49
43 46 50 40 45 42 33 35 43 49 51 51 51 52 50 42 49
49 50 50 52 52 27 42 49 50 50 54 54 42 54 54 54 54
57 42 51 50 50 54 51 57 57 57 42 50 52 54 42 51 51
42 50 54 50 54 57 57 54 50 54 52 53 45 57 57 57 57
57 57 53 53 57 57 57 57 57 57 57 57 53 53 54 57 53
53 57 57 57 57 63 63 63 63 63 63 63 63 63 58 58 63
58 63 63 63 63 63 63 58 63 63 63 63 54 63 63 63 63
63 63 63 60 63 58 63 63 63 43 58 50 63 58 63 63 63
58 63 63 63 63 58 63 63 63 63 63 63 63 59 52 63 59
60 59 60 63 63 57 63 57 57 57 60 57 52 60 57 63 63
63 63 60 63 52 57 52 57 57 57 63 58 46 60 63 63 57
63 63 59 63 52 63 63 57 59 57 63 43 52 57 63 63 63
57 63 57 63 60 54 58 52 63 57 59 54 58 63 60 63 63
63 54 63 63 63 54 52 44 54 54 63 54 63 63 63 63 58
47 63 63 63 49 63 60 54 63 47 58 44 54 58 63 60 54
60 50 50 50 60 49 60 50 63 59 59 60 63 50 45 42 63
60 60 58 49 60 60 60 58 58 44 27 52 35 58 42 49 63
39 60 51 51 44 54 50 60 47 63 60 63 63 47 54 50 54
54 60 63 50 51 49 49 51 51 46 51 49 50 50 54 54 54
54 50 49 42 30 29 44 50 50 50 57 54 49 50 57 50 49
49 49 50 54 54 42 51 49 46 50 42 49 49 42 39 53 42
54 50 34 50 54 57 39 50 42 49 42 43 54 50 50 54 38
49 47 36 53 53 43 57 31 50 57 43 54 54 42 50 39 34
54 31 50 42 42 39 50 35 50 42 42 54 54 39 54 34 29
45 45 50 50 28 34 54 39 39 42 44 18 42 39 54 49 22
46 54 42 27 49 50 42 49 54 33 50 37 57 54 57 33 57
22 54 33 34 59 43 54 54 54 25 42 18 57 37 31 57 27
50 31 54 42 42 50 59 59 59 54 35 49 33 50 35 46 50
50 54 42 37 43 42 59 34 54 50 57 59 59 59 33 50 30
44 54 25 50 31 42 30 59 42 42 59 59 59 54 43 42 43
44 21 44 59 29 59 46 42 44 31 42 30 59 59 59 59 31
29 39 17 42 44 34 42 42 42 31 44 39 43 34 36 24 44
6 43 27 44 44 16 31 44 44 39 33 44 44 22 31 33 35
44 49 47 31 44 44 32 11 42 44 44 13 12 16 14 44 35
24 14 28 9 11 16 35 32 35 38 34 38 35 32 18 14 14
30 33 14 29 27 29 35 47 12 29 20 27 12 21 14 23 44
44 38 30 33 33 31 38 27 46 21 19 14 46 14 46 35 35
46 46 46 46 11 15 20 27 30 22 17 14 25 42 13 16 16
12 16 14 17 11 22 34 14 22 35 29 46 21 10 10 11 18
15 15 15 20 14 8 26 30 20 16 8 12 19 16 13 20 13
12 11 10 20 19 10 10 19 19 20 10 10 16 12 24 18 20
18 12 15 12 11 12 12 14 16 31 17 10 11 13 27 18 13
32 15 12 14 11 14 14 12 11 12 11 14 18 9 14 10 12
10 17 17 11 12 13 15 11 10 11 19 32 28 17 18 11 11
9 6 11 11 11 32 17 12 11 18 14 19 11 14 14 21 13
11 15 26 12 13 11 12 11 12 12 14 27 10 8 10 11 14
13 13 11 10 10 10 10 11 14 13 9 11 10 8 11 9 34
18 10 12 14 11 11 12 10 8 11 10 28 11 11 11 15 15
18 15 16 15 11 18 11 8 6 14 15 22 10 21 14 11 10
11 11 11 15 15 11 15 11 14 13 13 16 17 17 8 11 11
20 10 9 17 11 11 13 11 15 11 14 10 11 10 16