S03036-02_C06
Seqid S03036-02_C06
Sequence >S03036-02_C06.phd
NNNNNNNNNNTTTTNGNNNNNNNNNNNNNGGCGATTGGCGGCCAAATCGGCCGAATTCCC
ATGGGGATCCGATGATCTTTAAGATNNNAAAAATTGTCTATTGTTTAAAAGATCTCATAG
CGTGACATCCGTATATGGGTGGGTGACCCGAAATTTGAGCCTCCTTCTTGTAAAACGAGA
GTTTGTCATAGCAACGGACCAACATGTGGTAAGGTGAAGTTGACTCAATTTTTTCAACAT
CTTATATACAATATAATAATATGTAGGTAAACGTGTCCATAAAATGGTTTTATGGAATAG
AAAAAGAATCCTTATGCAAAATTTTGGTCAAACCATAACAAATTGGAAAATANATCATCA
TCGAAGNCAGTANGAGAGTTCCTTATTTTACTTTATTATATAGAACATCTGANGACATCT
AGTATCAGTCCCTAAAANTGGGCAANATTAATNNANNAAGGGACAAGAAACCCCGGGNAA
AGGGAAGGGAGGCGAGNGGGTTATNTNAAANATATGATATGGTTGTCGGCGTGAAGNNGT
NAAGGACGGGAAGAAANGNAAGTNNCNCTAAAAATNAAANTGCNCNCAACCCTTATCGGA
ATGGNCNGTNGNATNNCAGAATNACGTTNCTGCGGAACTAAGGGATATANCTCGAGANTG
NNNAANGNGTGAGNGCNGTNNNNGGNACAAAATNTGGTAGACTTATAGCNANNNNNNAGG
GNANNNAGTGCNNGCNNAATTNANNNGANTNGNNANGTCACGNANNTNAGCTCNNNANNN
ATAGCGNNNNCAANTNNNNGACAAGANNNCNNNNGNANANAANNTTCACTGNNCCCAACN
CGCNNNCANNGNNANGANNCNAGCNANGCNNNANN
Quality >S03036-02_C06.phd
5 4 3 2 3 6 6 5 5 6 12 11 8 8 5 8 7
7 3 5 6 7 3 3 5 5 5 6 5 15 13 9 29 41
16 36 33 15 16 31 24 17 20 10 10 9 19 36 46 35 40
36 41 40 14 42 46 32 28 27 24 35 46 41 29 45 21 21
49 50 43 44 47 47 32 32 44 46 46 52 57 52 60 16 8
7 7 6 8 9 41 22 18 15 27 48 37 60 46 53 52 60
52 32 47 28 33 36 28 39 53 37 33 47 46 46 41 45 45
42 53 53 60 52 20 45 19 44 44 38 60 57 53 57 60 52
57 57 53 57 57 57 53 53 57 40 32 60 52 60 52 57 60
52 57 57 57 60 57 57 57 57 57 57 60 52 57 57 60 60
53 42 53 53 52 52 53 52 53 52 60 60 57 53 53 53 53
53 57 52 60 57 60 57 58 52 60 52 52 58 52 60 57 57
60 52 52 52 52 57 57 60 57 52 52 60 53 45 41 53 53
47 53 53 53 57 42 28 47 53 45 24 20 24 13 10 10 10
10 14 10 10 9 14 10 10 14 10 29 14 23 38 53 60 45
53 60 41 41 47 53 53 57 53 53 53 37 34 20 39 47 53
53 53 53 53 53 52 52 57 52 57 53 60 52 60 53 47 53
53 53 60 53 53 45 35 46 46 40 26 37 42 34 20 23 10
38 38 27 28 42 35 53 53 53 42 38 23 42 35 20 35 35
23 42 35 10 11 14 23 24 23 28 11 10 11 11 14 13 24
15 11 19 13 14 14 20 13 13 10 9 11 6 20 23 34 18
11 18 10 13 22 11 12 14 9 6 8 10 9 14 19 6 35
53 12 16 9 11 37 34 9 9 12 9 19 16 38 33 38 24
22 11 9 9 12 24 14 13 10 8 9 16 35 13 11 9 10
34 10 20 19 6 9 8 12 12 13 11 8 9 14 10 14 14
18 9 11 11 10 20 32 34 16 10 9 9 7 10 14 8 11
11 10 12 7 10 10 14 9 9 9 6 6 10 7 7 9 10
9 9 18 9 10 9 12 11 13 16 13 24 11 9 19 11 10
9 6 11 10 14 19 14 8 15 9 10 10 13 14 15 12 11
8 12 16 6 13 22 15 16 10 10 9 6 11 6 9 11 20
6 16 11 14 20 10 11 11 9 10 11 24 9 10 19 11 11
12 9 13 17 9 21 13 11 11 7 6 16 16 7 8 9 10
19 16 14 11 16 9 24 19 9 10 11 9 6 11 6 11 11
8 20 6 6 11 6 11 8 9 9 29 14 15 8 7 23 9
13 6 9 14 9 6 8 6 10 9 11 18 11 19 12 8 9
9 9 15 10 10 9 10 8 8 7 9 6 10 9 6 9 6
10 8 7 7 9 8 10 11 9 9 6 19 10 11 9 9 7
8 9 10 11 11 9 9 11 9 9 10 11 10 9 9 14 11
10 10 25 6 9 9 13 11 8 10 9 6 11 9 6 6 6
10 11 6 11 6 8 9 9 19 9 6 11 8 6 13 9 6
7 6 7 9 9 6 12 9 13 25 9 8 8 7 9 11 8
8 9 8 10 9 8 9 23 8 10 9 19 6 11 5 5 6
6 6 6 13 10 8 9 6 11 6 6 6 11 8 8 15 9
5 6 10 8 5 6 8 11 8 11 7 11 5 5 7 9 14
7 11 5 11 5 5 8 6 9 11 11 10 9 10 6 8 6
5 8 6 9 9 9 9 11 5 6 5 8 5 5 5 11 9
11 10 19 8 6 7 5 5 14 14 15 6 11 5 5 5 5
16 23 11 11 9 13 15 5 5 6 10 5 5 5 6 9 5
10 5 10 7 9 8 6 6 11 9 8 11 14 10 8 5 5
9 14 10 11 9 8 6 9 11 19 5 6 7 10 9 5 5
11 5 6 10 5 9 19 5 5 10 6 14 9 9 5 18 5
11 9 5 6 6 14 6 5