S03036-02_C10
Seqid S03036-02_C10
Sequence >S03036-02_C10.phd
GGGNNNNNNANTTGNTNAGGGNCNNANNATNGNNGATTGNAGGCCAAATCGGCCGAATTG
AAGTTCGTATATGTTAGTTTTCTTTTACTCCAAGGGTTCGTGACGTCGAATTCCTATCAG
CTTTTTTTGCGCTTGGCGTTCTAGGTCCCTGTGCCCGTCTGAAACTATTCGTACATAGCA
TTACTAGAGTACATAATATCGTCTACCATACATACGACAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAATTTGTACCGGCCATAAGGGCCAGCTTGAGTATTC
TATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATT
GTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGG
GTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGT
CGGGGAACCTGTGGGGGCGGCGGCATTAANGAANNGGTCCAATCCGTGGAGAGAGGNAGT
AAGAGTANGAGGGGAGAATGGACTGGTGGAAGTTGAANAAAGNAANTAAATCCTACNAAT
NTNCGNACNGCTATNNNAAGGGAAGNGAGATNTNNTTATNNNAGTTAANTNAATNAGNTC
ATTCANGAAAGGTGTAANGGCTTGTNATCTTNAAATTGNCGTAAAGANTTGANATTNTAC
NAGAAGGACCAAAATGGNNAGATATCNGCGGTGCTNANNGAANTNTTGATGAACGTNNTA
TTGCACGNATAACANNNCCGGANATTATNCNNGAGNTAGTNANAAAATCTCNATAAACTA
TGNAGGCGGCTANGNGAAAANAANNACCCANTTGCTGTANTANNAAAANGATACTTG
Quality >S03036-02_C10.phd
19 19 22 7 6 6 6 6 6 10 7 10 12 9 7 9 7
9 9 10 8 5 14 6 6 8 7 5 8 9 5 8 7 5
10 12 24 26 16 7 9 9 10 9 12 11 9 13 28 16 26
24 28 28 18 22 13 27 23 13 9 8 9 22 31 25 22 13
25 44 28 33 47 44 20 33 24 33 39 28 27 28 25 46 47
32 14 45 47 46 28 15 24 39 53 44 42 39 45 24 34 53
32 32 41 32 39 24 39 42 27 33 32 26 41 42 42 35 42
35 45 45 53 53 53 60 57 60 52 50 23 53 53 53 53 39
39 47 60 52 53 53 53 42 57 53 53 60 52 52 52 52 52
53 60 53 53 52 52 52 52 53 38 50 50 53 53 52 52 53
53 53 60 60 53 52 53 53 50 52 53 53 40 53 53 52 60
52 53 53 57 52 57 57 53 60 42 40 33 40 24 53 53 52
57 57 52 53 53 44 37 37 53 31 44 34 53 53 50 40 53
37 42 27 42 38 53 53 40 25 25 28 23 18 14 14 14 22
15 14 14 18 14 19 14 16 14 10 19 19 28 26 32 40 42
26 32 22 19 23 23 24 24 23 24 9 9 10 9 8 40 34
53 57 60 53 42 42 35 50 45 52 52 60 39 42 53 35 32
40 53 52 52 53 53 46 32 45 45 41 32 34 40 41 20 20
30 24 53 41 34 33 27 53 53 41 40 41 45 53 34 24 45
42 33 40 29 41 53 53 45 34 35 60 60 29 47 39 41 42
30 35 27 27 32 39 30 35 47 27 45 28 45 35 42 47 57
42 21 32 37 41 28 28 35 46 41 29 31 35 27 28 24 28
46 47 57 47 42 35 34 19 35 35 44 25 30 39 30 28 19
47 46 46 35 28 24 35 42 35 35 28 28 35 42 46 29 35
47 28 41 57 47 41 42 47 35 47 48 48 29 28 29 33 40
42 42 47 28 34 42 42 42 52 46 47 41 47 37 39 31 28
37 41 22 28 42 32 37 29 41 47 46 24 14 37 33 31 36
32 30 18 27 13 18 16 35 39 39 23 13 18 18 42 36 32
13 11 10 16 18 24 47 17 11 11 28 24 13 12 18 9 12
17 10 27 10 10 14 11 14 11 18 14 13 16 12 10 11 6
11 11 11 6 6 11 14 9 11 10 8 11 11 11 25 13 17
22 11 10 10 18 9 14 11 10 6 15 9 11 11 25 9 9
9 10 9 6 10 10 8 11 11 9 14 9 11 10 9 9 9
10 10 14 9 11 32 22 20 16 14 10 15 10 11 11 11 6
14 9 15 14 6 14 11 6 8 9 9 9 11 15 10 8 10
9 7 11 13 9 7 11 6 8 9 7 9 10 6 9 10 10
9 13 7 6 6 11 9 10 9 14 10 8 8 6 9 9 8
9 8 7 9 6 6 9 11 11 11 5 6 5 8 9 8 10
14 9 6 14 6 14 8 8 6 9 14 6 9 8 19 9 14
11 14 6 9 9 14 11 14 10 11 9 8 9 9 6 14 14
9 10 9 14 11 6 9 11 11 11 10 6 9 9 9 10 8
11 7 8 14 11 9 14 9 10 8 6 8 11 9 10 6 12
13 11 6 9 8 8 7 11 8 11 11 10 11 9 8 10 9
8 14 10 9 10 14 7 7 10 8 11 8 10 8 9 7 9
11 14 14 9 11 11 9 6 10 7 7 10 14 9 6 11 6
14 14 9 10 14 11 9 9 9 10 11 6 6 9 9 11 10
10 9 9 8 9 6 9 9 8 11 9 8 6 6 6 9 9
10 9 8 6 10 9 10 14 9 6 11 6 6 8 9 11 7
11 9 8 9 6 11 6 9 10 10 9 10 11 10 9 6 20
9 14 16 14 14 14 10 11 11 6 8 11 9 9 9 14 9
9 9 6 9 6 9 14 14 11 22 6 9 14 6 6 9 10
9 9 14 6 9 10 11 9 9 14 11 9 6 8 10 6 6
9 18 9 14 7 11 9 11 8 9 9 8 8