S03036-02_C11
Seqid S03036-02_C11
Sequence >S03036-02_C11.phd
TNNNNNNTNNNNNGNNNNNNNNNNNAGGGCGATTGGCGGCCAAATCGGCCGAATTGAGAC
GAGCAGATGGGAATTAAAGAACTATCTACAGAGCTCTTTACTAAATTGAATCAATAATAC
ATACTTACAAACATGTCACAGATAGCACAAGAAATGACAGTGAGCTTAAGAAACGCCAGG
ACACAATTGGATATGGTCAATCAGCAGCTAGCATATTTGGACAGACAAGAAAAGCTTGCT
GAATTGACAAAGAAAGAACTAGAGTCTTATCCAACGGACAAAGTATGGAGATCTTGCGGT
AAATCGTTTATCTTACAGGATAAATCCAAATACGTTAATGATTTATCACATGACGAAACT
GTTCTTCTGGATCAAAGAAAAACATTAAAGATAAAAAAGAACTATTTAGAAACTACTGTT
GAAAAAACAATAGACAATCTAAAGGCATTGATGAAGAATTAAAAGAAAGCGGCAATAGCC
TTTCCTTTCTTAGCCGGAAAACTTACTACGGGAACAAGTTTTTTTTATTAGTATAATGTA
GATATAAAAGCTTANAGTTTATATAAATATAATAAAAGGTTAAGCACTGCTGCTCCCCCC
CCCCCNNAGGGGGAGAGNANGAGGAGNANNTATNNNNATTTTTAATAANAANNAAAANGG
NNACCNGGCCNNAGGGGCCAGCTTGNATTNTTCAAAGTGGNCNNTANANANCATNGCGAN
ANNANCNCNNNNNGGGNNCCGGGGGGAANGGNGAAACCATATNTTTTCTATNTANNATCN
AGCCGNAANTANAAGCGAAGANGCNGGGGTGCGNATGGANGNACAAAAAANAAAGANNAN
NNTGANCNNCNCNNCNGCTATGCAAGANGNGANNNNNGNNNNNNNATTGATATTCTTNTT
TATNNACAGNNNNAGACAGNACGA
Quality >S03036-02_C11.phd
9 5 3 3 2 5 6 8 6 6 5 5 7 10 5 3 3
7 5 5 6 5 5 3 3 8 9 14 13 10 20 22 25 30
25 13 17 30 26 26 27 12 15 17 35 31 31 32 35 31 28
28 9 26 36 23 13 16 20 24 34 42 44 37 28 21 20 31
42 36 33 29 25 28 33 28 49 49 46 54 36 31 32 30 32
32 50 43 42 27 39 32 35 37 35 35 35 39 44 39 38 38
36 33 33 32 38 44 32 35 42 47 44 42 44 44 42 44 54
50 47 49 49 46 43 42 47 47 44 47 60 50 44 47 46 57
52 57 57 52 52 54 60 57 60 58 57 63 63 63 63 63 60
52 52 60 52 54 52 58 63 63 58 57 57 57 52 58 60 57
63 60 57 52 54 52 52 54 52 63 45 52 63 60 63 63 63
63 63 63 63 52 57 52 63 63 60 58 57 60 57 57 52 57
57 57 60 57 52 57 57 46 60 57 57 52 57 60 57 57 52
52 52 59 52 60 52 57 57 52 60 60 60 57 52 60 57 57
52 57 57 52 57 52 58 63 53 57 57 57 60 57 54 60 57
60 57 57 52 58 57 60 58 60 63 57 57 57 60 63 63 52
52 63 60 58 58 63 60 57 63 63 63 63 57 52 63 63 63
63 52 52 63 63 63 63 53 63 63 57 60 60 57 57 63 53
53 63 63 60 57 60 60 63 60 57 52 57 60 52 42 63 63
52 52 57 52 52 48 57 60 60 52 43 48 48 48 43 43 43
41 48 48 43 43 43 48 46 57 57 60 57 52 48 47 48 48
52 52 60 60 57 57 60 57 63 63 58 63 63 52 52 57 60
58 60 57 53 57 57 57 52 48 48 52 53 57 60 48 48 58
47 58 63 63 63 63 63 57 63 57 52 57 60 57 63 58 52
57 63 63 57 52 53 52 57 60 58 57 60 60 57 57 57 57
57 57 60 52 60 60 60 57 52 57 52 48 60 60 63 57 63
63 46 53 47 57 52 48 43 48 42 57 52 48 33 43 35 25
43 36 36 21 23 23 20 16 21 21 32 35 32 33 30 43 48
60 47 52 52 57 60 57 52 52 42 60 40 52 42 47 52 42
57 48 52 57 52 60 47 46 42 60 40 40 43 41 47 47 28
42 42 52 52 47 34 44 52 57 57 57 60 60 60 60 47 44
39 35 39 44 47 54 44 42 40 42 47 42 25 23 42 35 35
33 28 27 22 21 23 44 21 12 17 6 13 39 35 50 42 43
34 22 39 12 42 34 33 32 32 28 38 30 42 34 29 27 17
32 17 22 16 27 14 27 17 19 13 12 14 13 12 10 16 13
26 18 28 17 18 16 19 10 15 10 7 6 9 17 18 19 12
18 14 11 10 10 7 9 6 12 9 14 10 12 10 7 10 6
6 10 10 9 7 6 6 6 20 9 12 10 16 15 13 9 9
15 17 5 13 17 3 5 14 33 32 9 6 9 10 7 7 10
11 12 7 9 16 18 20 7 6 18 12 10 32 24 11 11 16
20 17 14 17 9 6 10 9 9 6 10 21 18 9 12 10 9
10 20 8 5 9 6 6 9 28 7 28 6 9 7 14 15 8
7 16 17 9 13 7 12 6 7 8 7 9 5 9 3 5 7
7 5 9 9 10 7 7 20 17 26 11 9 15 10 16 12 13
7 10 14 6 12 9 9 9 9 9 11 17 13 12 6 10 13
15 10 10 14 11 15 6 16 18 6 5 9 11 10 6 15 10
11 14 16 6 15 12 6 10 19 6 16 14 17 11 14 17 22
8 15 7 12 14 7 10 27 26 13 13 17 11 9 6 30 14
17 9 9 5 12 6 17 12 25 9 29 14 11 15 7 29 21
27 13 19 6 7 8 5 3 7 15 11 15 5 8 5 6 11
6 9 6 5 13 6 15 17 8 9 12 19 14 9 10 29 10
6 22 6 10 8 5 6 6 5 5 8 6 5 5 5 5 7
6 12 8 11 10 14 10 9 44 27 8 9 9 7 17 13 19
12 9 6 6 16 8 22 11 7 6 6 5 25 14 8 12 18
10 6 27 8 17 12