S03036-02_C12
Seqid S03036-02_C12
Sequence >S03036-02_C12.phd
NNNNNNNNNNNNTNNNNNGNNNNANNNNNGGGCGATTGGCGGCCAATCGGCCGAATTCCC
ATGGGGATCCGATATCAAGCTTGGGCCCGGTACCGGCCATAAGGGCCAGCTTGAGTATTC
TATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATT
GTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGG
GTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGT
CGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTT
TGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGC
TGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGG
ATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAAG
GCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGA
CGCTCAAGTCAGAAGTGGCGAGACCGGACAGGACTATAAAGATACCAGGCGTTTCCCCCC
GGGAAAGCCCCTCGTGGGACCCTCTGGTCCCTACCCTGCCNCTTACCGGAAACCAGACNC
CANATCCCCCATCCACAATCGGGGAGGTGTCGAGAAGGGGGGGGGGGTTGGTTTTATTTT
TTTTTATGTNGGTCATAAAAAAAAAAAAGNCAAAATAANCATAACCCCCTTTCAACCTCA
AAAAAAACCCAACACACTAACATCTCCCCCCTGGCGGGAGGGGGGAGAGNGGAGGAGTGT
TATAATTTTTACGNNTTAAAAAAA
Quality >S03036-02_C12.phd
5 4 5 5 2 2 5 3 3 3 5 5 19 7 5 7 7
5 12 5 3 7 5 8 5 5 5 5 5 12 29 19 11 27
34 20 42 35 14 13 40 21 15 16 22 20 41 40 47 25 34
47 47 34 16 31 40 36 27 29 18 41 51 51 49 50 19 16
40 43 40 43 40 50 37 30 50 42 40 40 49 49 43 49 42
50 54 43 49 54 35 30 31 49 40 33 41 42 33 54 54 59
50 53 42 50 50 44 54 49 54 50 51 45 50 50 50 42 49
49 44 44 47 47 60 54 63 60 54 60 50 50 50 63 60 57
59 54 50 51 58 63 58 44 44 47 50 63 60 58 63 51 63
63 63 63 63 63 63 63 63 63 58 63 60 58 63 63 63 63
63 63 63 58 63 63 63 63 58 63 63 63 63 60 63 63 43
63 63 63 63 60 63 63 63 63 63 63 63 58 63 63 63 63
63 63 63 63 57 57 57 58 59 63 63 63 63 63 58 58 63
63 58 57 60 60 60 43 43 60 60 57 57 52 52 60 48 58
53 53 53 60 63 53 58 58 58 58 58 63 57 63 63 63 63
60 63 63 59 63 52 63 63 60 60 53 63 58 58 63 63 63
63 63 63 63 63 57 58 52 52 63 63 57 63 63 63 58 60
58 57 63 63 63 57 63 52 52 63 57 60 58 63 63 63 63
52 52 63 63 63 63 63 63 63 63 52 58 52 60 58 58 58
57 57 52 52 46 43 43 57 57 57 49 50 60 45 50 50 51
60 49 60 57 54 54 60 60 49 51 38 44 45 47 45 42 63
58 44 50 49 63 42 49 49 54 50 63 63 51 50 50 47 50
54 49 60 50 50 49 50 50 51 49 60 49 49 47 54 50 50
54 60 54 54 50 63 47 58 63 50 50 54 59 49 60 49 54
52 54 59 50 50 49 49 49 49 54 50 46 57 54 50 39 42
44 50 50 46 42 42 39 42 44 46 49 49 43 49 54 50 49
46 49 49 42 44 44 35 45 42 42 46 38 39 42 28 42 50
39 44 27 39 42 39 39 42 39 42 39 39 43 42 39 46 20
39 59 50 42 44 28 39 39 44 36 43 35 19 39 42 44 42
30 46 42 42 49 50 49 54 35 43 14 27 15 39 42 44 27
38 19 35 29 17 21 18 18 39 39 39 44 21 31 39 18 44
42 43 42 50 39 42 44 42 46 46 35 20 21 27 28 36 30
28 39 42 50 39 27 36 39 43 21 44 44 31 39 44 44 34
39 21 39 28 29 41 23 27 36 36 22 26 39 36 39 36 36
31 36 17 12 9 29 25 22 14 28 22 28 31 27 10 21 22
14 11 18 11 16 19 10 28 23 29 25 23 23 21 14 17 15
22 11 19 24 44 44 11 29 14 9 11 24 14 9 9 27 13
14 31 34 18 19 25 15 13 8 27 34 15 16 16 11 13 12
10 14 31 12 10 25 23 13 9 22 25 30 19 11 9 15 47
20 20 14 9 10 9 13 18 17 12 13 13 16 13 9 13 13
12 11 11 16 14 19 9 26 13 36 10 10 16 12 15 27 14
20 18 11 6 18 17 22 13 19 18 22 15 15 22 11 11 10
31 18 13 13 6 11 9 11 6 8 10 9 16 27 32 32 14
14 21 15 10 14 17 11 10 10 13 11 14 14 14 9 9 12
13 10 10 19 13 15 14 19 10 35 21 15 15 20 32 28 11
14 12 9 9 11 11 12 14 15 14 13 12 14 24 32 15 34
16 10 8 11 16 14 13 7 9 9 9 18 12 14 9 18 17
18 37 17 18 26 53 53 33 19 9 6 9 18 14 13 13 14
21 10 6 9 20 11 27 19 13 11 11 11 15 11 19 12 14
11 14 16 11 10 16 11 22 24 9 10 18 10 14 11 14 12
11 14 13 19 13 9 10 14 18 14 12 12 15 24 18 14 15
22 16 19 14 15 20 14 10 14 12 10 13 16 14 11 23 14
14 11 14 11 10 6 8 11 18 15 9 14 15 15 11 10 11
11 11 24 10 20 26 14 9 18 14 9 9 6 6 9 10 16
15 10 18 32 15 11