S03036-02_C14
Seqid S03036-02_C14
Sequence >S03036-02_C14.phd
CNNCNNANAAGGGGNGGATTGNNGGGCCANATCGGCCGAATTGNTGGANTAAGTTGTCTC
TCGTTCGTCCATACTGCACTTTTCTCTTTAGTTGTATGCTTTATAAAATTGATCCGTGAA
AAGTTTTCCACATAATAAACCAAGACAACAGGATTGTTTATAACGTTATAAGAAAGCAGA
AGAAAATTTGCTGTGCGTTGTTTCCCTAATATCGCACCCAAAGAACCACGACACATCATA
AAAGGAGCTATAGCTTCAACTCTGACACAATTTTTTGTCAGTTTATATTCATCTTCACAA
AAAAAAAAAATTATACAAATATAGAAAGAAATAACTCGCCCAGCTTTTTTTGCATAAAAA
GATAAGTGCATTTAAATTTATAGAGACCACAACAAACAGAAAAGAAAAAACAAGCATACA
CAAACAAAAATGGCTTTCAAATCATTCATATACTCTAAACNNTATCATCGTTGCGCCGCT
NGAAAGGAAAACTGCAAAATTTTTTTTCGANAGCTACNAAGCAGTGTCNAAAGNAAAACN
AAGGNGGTGNNGANANTAANGNTGGCNTGNAGCATGNATGAGAATCTAAAANTACCCNGG
GGGGGGNGANGGGNGNAAAATAGAATAATCTATGTGACAGGGGANTCCAGGGCGAATGGC
NTTGTAGGACNAGAATGGGAANATGGTAGNNAGGGAAGGGGAGGAGGCTTANTCGATTAC
TCCTCNNCGTCNGGAAAGAAGNNGNNGNNAAGTGATGATTTAATTTAGAAAAAGNGATAC
AAGCAAGGCGTAGTGGANACACGAAAGACGANNAAAAAAGATAGTGGGAAAAAATAAGAA
AATAAGTAAAACCAGGGAAANGGAGGANANGGGTGNGGNNAAANANNAGGAGATAANNAT
AATTNAAGNN
Quality >S03036-02_C14.phd
10 6 7 8 5 5 8 5 9 10 8 11 27 21 5 9 13
12 10 12 9 6 5 8 14 14 8 9 8 6 9 14 20 27
22 30 38 31 38 15 26 17 9 6 13 18 17 21 6 12 19
16 18 25 18 14 9 9 12 14 15 22 19 12 21 31 34 46
29 29 16 35 35 42 35 47 39 46 46 36 29 23 23 39 35
39 33 46 46 46 53 27 32 26 16 24 14 40 20 19 24 20
34 24 19 26 23 23 18 46 53 45 45 45 45 42 41 53 42
39 53 45 53 52 57 53 53 47 37 33 53 45 53 45 53 53
44 39 53 57 52 52 52 53 37 53 46 46 53 46 53 53 33
32 47 57 45 53 53 37 53 35 53 52 52 53 52 60 52 52
52 57 52 57 53 53 57 52 57 53 57 57 52 54 57 57 52
57 53 53 52 60 57 53 57 53 53 53 53 57 60 60 52 53
60 57 53 53 53 53 53 46 47 39 35 33 33 36 22 18 25
25 42 31 20 19 23 18 27 34 29 28 22 41 14 45 53 53
52 52 43 53 60 60 60 53 53 53 60 57 60 52 60 53 57
57 52 53 53 60 60 60 60 53 53 53 54 57 60 53 57 57
60 57 57 52 52 53 59 59 60 53 53 53 57 53 53 52 57
46 32 53 53 60 60 52 45 53 52 60 57 52 52 60 57 57
60 60 57 53 52 53 45 53 53 52 53 53 60 57 52 52 40
29 37 53 53 60 41 34 21 33 36 47 53 45 53 33 27 38
34 25 53 41 53 45 42 47 45 42 42 53 53 53 53 40 40
37 60 53 52 53 42 42 53 53 60 52 53 27 53 53 52 45
53 53 52 53 53 45 53 42 42 53 57 53 53 32 37 35 25
27 53 46 46 42 33 14 41 30 42 40 25 18 17 20 46 53
46 45 41 22 24 32 33 14 34 25 19 28 28 32 39 37 14
11 28 35 29 35 23 38 27 25 34 33 33 17 22 27 27 27
24 27 24 23 19 9 18 25 23 21 17 18 39 26 24 20 9
9 6 7 10 29 25 27 16 13 12 9 10 14 9 14 32 25
28 33 14 9 7 9 10 14 23 13 12 27 37 26 19 25 30
42 24 19 10 8 11 14 8 17 23 30 11 11 11 9 10 9
6 15 12 10 9 10 9 6 10 19 9 11 24 10 9 8 9
11 6 12 10 9 11 6 9 11 10 14 9 6 9 11 11 9
6 9 10 11 10 6 6 8 12 6 9 6 11 10 10 7 9
6 9 9 12 10 7 8 11 6 9 12 10 8 10 9 7 11
15 11 18 11 24 11 14 10 10 13 11 12 9 6 9 10 16
10 10 6 8 13 19 11 15 19 12 14 6 9 8 6 8 14
9 7 16 6 9 9 10 16 14 15 10 13 10 8 27 15 11
11 14 12 11 11 12 11 14 9 18 11 15 10 10 19 6 9
9 11 14 13 8 18 9 8 18 13 12 10 13 9 6 15 9
12 11 11 17 18 11 8 7 9 10 24 11 11 13 12 14 20
19 7 22 11 14 11 10 10 13 7 6 14 13 11 17 17 17
11 12 10 9 9 8 11 8 11 17 12 14 11 13 6 9 10
9 11 11 13 12 13 9 14 23 16 16 7 6 11 10 11 10
7 8 12 9 9 12 21 15 10 9 6 6 19 6 7 14 6
6 13 13 10 9 11 9 9 12 13 13 11 16 12 12 11 11
14 14 9 11 17 15 13 11 11 7 9 11 14 21 14 13 15
17 10 8 9 10 9 11 16 11 13 13 16 12 9 11 6 14
10 18 9 9 9 14 22 11 12 11 11 11 7 7 18 14 14
18 9 9 9 10 9 12 9 9 10 11 13 9 29 12 28 11
10 9 27 9 9 10 14 9 14 9 9 10 9 8 8 14 14
12 9 10 10 10 11 14 9 9 14 6 23 15 8 10 8 9
6 9 6 17 9 14 10 10 6 12 11 7 6 11 11 9 6
9 7 6 10 25 21 17 9 8 9 9 9 6 6 21 16 16
9 28 14 6 11 11 10 6 6