S03036-02_C15
Seqid S03036-02_C15
Sequence >S03036-02_C15.phd
TNNNNANTNTTTCNNNNNCCNNNNNNATAGGGCGATTGGCGGCCANTCGGCCGAATTGGA
ACTGAATAATCGTAAAAATGCCAAACAGGTCTGAAGAACTTGACCGATTACTCGACAAAA
TAATCAACTCTCCGCATAGAACAGAGGCCTCGAAGACTTTGCAAGAAATTGAAAATAATC
AATCATATATTTTAAATGTACAGTTGAAGAAGTTATTGCGACTTCATGACGACTCATTTA
AAAATAAGTGTGTTTCTCCTATTAACTATATGTTGGAAAAGTACACTCCGTATATGGGGC
ATACCGAAGCATTACAAAAGGAAGCAGAGCTTGTGGATAGGGATCTCCGAATCATTGAAA
TGACGTACCAACTGATAAAAAAGAATCGCAACTCGAAATAAAACGATAAATATATTCAAT
GTTTTTAAATTAGTACTATTATTATATGTTATTATTAATGGAATGANNCNNTACGCNCAC
NNAGGGAGGANAAANAAAAAGGAAANNTNTTAAATTNTAATAAAAAAAAAAAAANGTANC
GGCCNTAAGGCCCTTTTTGTTTTTGCTTAANGNAAACAANANAAATAACGACAACCCTCG
CCNNCCCTCCTGCCTNGGGGAANAGGGGGGGGGGGTAATTTTCATTTTATTTANAAACCG
AAAGAAGCANANTACCACCTGGGNTNTTCGTNGGAGTTATGAGAAANAAANTAAAANGTC
AANAAACNCCCCCCCGCCGGAGGAGGGGGGGGGTGGAGGGTGGGATTNNTATTATGATAT
AAAAAGAAATGAATAAANNNAAANNNTGTTGATNNAGTTTTTAGAGGGTATGAAATAAAN
GNNNATNATANGTCGAATTAAATNNGCGNAAANGGAACNTCGATATTGCGGGAANNTAGT
GNANCCCAGATNN
Quality >S03036-02_C15.phd
10 5 5 6 5 8 6 8 7 9 10 13 9 5 5 5 5
6 9 9 5 7 5 3 3 5 8 9 11 8 8 16 12 25
21 15 28 29 19 13 31 16 9 14 8 7 21 16 16 14 21
21 12 20 12 27 27 19 15 12 15 22 24 39 31 24 27 22
21 25 23 9 31 39 42 47 39 34 32 32 32 41 19 34 35
27 11 13 27 23 39 42 34 29 13 13 20 13 29 45 47 53
32 37 42 42 26 16 23 23 24 19 34 32 39 42 28 40 40
28 24 20 24 28 45 31 23 31 35 23 34 41 42 34 41 24
45 28 22 29 32 46 33 26 53 34 53 52 57 57 60 31 37
60 32 48 53 60 57 52 53 53 46 45 35 37 19 32 33 45
45 53 47 47 53 53 40 40 45 45 28 36 53 45 42 45 52
57 57 53 53 60 52 57 60 53 57 52 60 60 57 52 60 53
53 43 53 46 47 53 47 45 53 45 40 37 42 53 42 27 37
37 36 31 53 28 42 53 53 53 40 33 30 23 23 23 18 20
16 18 18 18 34 27 35 27 31 42 47 53 43 53 52 53 53
53 37 34 31 30 41 57 45 42 35 35 53 53 57 53 52 52
57 57 52 52 57 57 60 53 45 53 53 57 53 52 57 53 53
53 42 38 42 36 45 53 57 60 52 57 57 57 53 53 53 45
53 53 28 45 39 53 52 57 60 53 53 57 52 38 57 57 60
45 53 53 53 52 46 60 53 43 53 47 53 46 52 45 53 53
45 42 30 35 47 30 35 45 36 44 29 44 45 36 35 35 44
23 27 20 22 35 21 16 28 28 26 27 30 24 35 47 42 45
32 39 57 42 46 53 35 27 11 18 30 37 47 24 24 18 13
24 37 46 32 44 52 47 43 60 60 60 43 42 26 40 37 35
57 52 37 30 22 30 35 30 26 19 32 41 52 35 30 30 35
34 39 47 41 43 48 47 31 46 41 35 32 34 48 40 41 42
32 35 25 26 24 42 23 16 35 28 35 16 19 14 30 39 35
39 30 30 23 22 22 10 6 7 12 6 6 18 9 21 8 9
6 13 9 10 6 6 9 14 10 14 9 15 9 10 6 8 9
8 7 8 9 9 10 9 14 15 20 29 10 6 7 8 6 11
11 10 9 10 11 9 7 13 8 10 14 9 9 10 14 9 9
11 20 25 20 20 29 26 7 9 16 9 6 13 35 17 9 11
6 14 16 14 27 18 10 12 12 9 10 13 29 32 13 17 12
19 11 12 8 11 12 10 10 11 6 16 7 15 14 15 10 11
11 7 11 7 17 37 21 10 16 10 9 8 13 10 20 11 11
26 9 13 9 10 11 11 6 6 10 18 12 14 11 11 10 9
10 9 8 6 9 10 22 13 10 8 7 10 9 15 24 28 11
28 18 33 46 14 16 9 10 11 13 18 10 12 18 11 15 9
24 11 8 11 9 13 28 6 16 15 12 17 14 11 10 19 15
11 9 12 9 8 9 7 9 7 18 11 11 12 12 32 26 14
10 12 10 6 11 6 9 12 17 9 23 6 10 14 9 9 10
12 18 9 13 10 9 46 36 13 7 11 9 10 6 9 16 20
20 11 6 8 9 10 9 9 6 9 9 11 9 6 11 14 10
11 26 13 19 10 10 9 11 11 9 11 14 8 14 15 11 9
18 14 9 9 9 8 22 17 9 25 23 23 9 14 9 14 9
9 9 6 6 9 12 9 9 11 10 9 9 9 10 9 12 9
11 23 9 11 9 11 11 11 10 14 23 12 13 14 14 7 6
6 23 20 10 6 6 6 9 10 9 11 9 9 8 7 6 9
9 11 10 23 11 9 9 9 9 9 10 9 9 9 9 13 14
14 12 9 24 11 10 7 9 6 6 6 9 9 6 9 8 20
6 11 10 11 9 22 12 10 13 11 12 16 9 6 7 11 9
8 6 8 8 11 6 9 8 9 9 9 6 8 9 11 8 14
9 11 8 14 8 9 14 14 11 8 6 6 14 10 8 8 10
6 8 6 8 9 9 8 10 10 9 6 6