S03036-02_C18
Seqid S03036-02_C18
Sequence >S03036-02_C18.phd
NNNNNNNNNNNNNGAATTGGCGGCCAAATCGGCCGAATTGACGATAACTGAAAGAAAAGA
TGGCTCCAGGTAAGAAAGTTGCTCCAGCTCCATTCGGTGCTAAGTCCACTAAGTCTAACA
AGGCTAAGAACCCATTGACTCACTCTACTCCAAAGAACTTCGGTATTGGCCAAGCTGTCC
AACCAAAGAGAAACTTGTCCAGATACGTCAAATGGCCAGAATATGTCAGATTGCAAAGAC
AAAAGAAGATCTTGTCCATCAGATTGAAGGTTCCTCCAACCATTGCTCAATTCCAATACA
CTTTGGACAGAAACACCGCTGCTGAAACCTTCAAGTTGTTCAACAAGTACAGACCAGAAA
CCGCTGCTGAAAAGAAGGAAAGATTGACCAAGGAAGCTGCCGCTATCGCTGAAGGTAAGT
CTAACCAAGACGCTTCTCCAAAGCCATACGCTGTTAAGTACGGTTTGAACCATGTTGTCT
CTTTGATTGAAAACAAGAAGGCCAAGTTGGTTTTGATTGCTAACGACGTCGACCCAATTG
AATTGGTTGTTTTCCTACCAGCTTTGTGTAAAGAAGATGGGTGTTCCNTACCGCATTGTC
GAGGGTAAGGCTAGATTGGGTACTTTTGTTAACCAAAAANACTTCAGCTGTGCATAGANT
AAAATGGTCTCCCCCCCTCACCCCCACCTTGGGGGGAGGGAAGAGANGAGGTATTATTTT
TTTTTTNTTAATAAAAAAAATTGGAAAGAAAGGCCCAACCCGCCCTGGGTAAGAGAGNGA
AAGAATTGTAATTCTAGATACATTCTACTACTCGCACTANCCAGAGTGCGGAGGAGAGGG
GGAGGGTGGGGGNTGATTTNAATTC
Quality >S03036-02_C18.phd
4 2 3 5 5 2 4 4 6 6 6 5 5 14 14 10 13
28 21 9 9 14 19 15 16 12 18 21 33 33 30 18 30 40
43 32 9 25 31 22 12 16 13 23 27 29 31 35 33 42 30
28 31 31 43 45 49 47 43 23 19 49 38 31 49 49 34 26
32 43 41 37 51 49 51 37 37 29 30 29 35 32 37 46 43
38 54 50 49 43 34 23 29 38 38 32 42 46 49 42 44 42
46 46 50 50 47 47 45 45 50 60 49 50 54 50 47 60 49
49 50 60 58 60 52 54 60 47 52 52 52 63 58 52 57 58
63 63 63 63 63 63 63 63 63 52 60 57 58 60 52 52 57
60 59 57 52 52 57 57 60 52 52 57 58 58 63 63 58 52
63 63 63 58 63 63 63 63 63 58 57 63 63 63 63 63 63
63 63 52 52 60 52 52 60 60 63 57 60 58 52 57 63 57
57 52 57 60 52 57 60 60 57 57 52 47 52 36 57 57 44
40 43 48 52 57 52 52 60 63 52 60 63 60 60 57 60 57
58 59 57 57 60 60 57 58 60 57 52 52 63 63 63 63 63
63 52 57 60 57 63 57 63 52 60 63 58 60 58 58 52 63
63 63 63 63 63 59 60 58 52 52 63 63 63 63 57 52 52
59 58 63 63 52 52 63 58 63 58 57 63 63 63 63 63 63
63 52 57 57 63 63 57 57 60 63 63 60 57 57 58 58 57
57 52 57 57 52 60 57 57 52 57 52 60 60 60 57 57 57
52 43 40 44 57 46 57 57 57 57 54 60 63 58 63 58 63
63 63 57 54 57 54 52 57 57 49 49 50 50 49 60 60 60
50 60 50 63 63 63 63 60 45 28 60 60 50 47 50 49 60
50 60 51 51 50 50 51 52 50 60 51 50 50 60 54 58 50
50 58 52 63 46 44 58 50 60 51 49 60 60 51 60 60 54
50 50 60 50 63 50 57 50 63 63 60 60 60 49 40 63 58
60 49 50 47 60 60 51 49 49 49 60 44 47 60 47 40 43
43 49 47 45 42 60 44 49 44 38 40 43 47 42 54 60 60
49 44 54 54 50 60 60 60 60 42 20 43 43 42 43 43 43
47 60 47 42 49 47 60 47 35 47 42 50 50 49 49 49 54
44 49 47 60 60 54 35 54 50 28 44 44 29 44 44 44 44
44 44 60 35 44 44 50 41 17 50 42 47 44 44 44 44 60
47 23 24 27 44 23 24 33 44 44 44 44 47 44 35 42 21
42 44 44 33 31 16 35 28 35 43 32 12 60 44 23 33 11
21 35 18 19 35 27 24 35 29 7 11 9 11 9 10 10 9
10 24 24 11 13 15 12 11 60 23 11 11 17 15 13 10 33
29 35 44 44 33 44 31 31 44 29 22 26 42 19 16 11 15
24 25 17 18 30 20 35 44 35 34 6 26 13 19 27 27 11
25 31 13 20 12 15 22 11 14 11 12 13 6 9 11 18 18
11 13 13 25 9 10 15 23 14 34 18 15 8 10 9 9 11
17 17 18 23 11 13 11 19 16 14 19 14 23 10 13 16 16
8 14 18 15 10 11 14 13 16 6 10 17 12 16 11 9 11
11 15 9 15 13 11 19 13 24 18 11 9 6 9 10 20 20
13 11 19 11 19 13 33 19 14 10 8 9 13 23 32 27 16
32 35 14 18 9 11 15 19 10 11 10 11 10 10 12 13 11
10 8 15 17 14 12 11 17 32 11 11 9 6 9 13 9 23
14 34 23 11 14 9 11 16 22 13 10 9 15 14 10 10 10
24 12 17 14 11 11 12 11 10 10 11 11 12 14 11 10 11
19 14 14 6 14 11 14 13 11 10 10 10 15 26 20 10 19
11 11 14 19 14 16 28 14 11 12 12 15 11 9 19 14 40
14 14 6 10 11 10 8 9 11 6 11 14 10 9 8