S03036-02_C20
Seqid S03036-02_C20
Sequence >S03036-02_C20.phd
TNNNNNNNNNNNGGCGATTGGCGGCCAAATCGGCCGAATTGACCTTATAAAAGAATTGTC
GATTTATCATTCCATAGAACGCGTTTACCCTCAGATGTTTCATCGCTAATAAAATTCGAG
CAAAGACCTGCAATTATTAACATCCATGGCCTTTTGGGCTCACACGTGATGTTTCATTCT
CTCAATAAGCTTCTTTCAAGGAAGCTTGACGCGGATATTTTTTCTGTTGATGTAAGAAAT
CATGGCATTTCACCAAAAGCAATACCTTATGACTACACTACACTGACCAATGATTTGATT
TATTTTATTGAAACTCATATTGGCTTGGAGAGACCTATTTATTTACTGGGATTCTCTATG
GGTGGTAAAATTGCATTATTAACCACATTGTATAAGAATATTAATATACGAAAGTGTATA
TCAGAAGAAAAAAAATAAAAAAAAAATAAAGAAAAAAAAAAAGAAGGGGNAGGGGNAAAG
GTCCCGGGCCATAAGGGCCACCTTGANTATTCAAAAAGGGTCACCTAAATAGCTTGCCGT
AATCAGGGGGCATAGNTGTTACCTGTGGGAAATAGTATACCCCCTCACCATNGCACAGGA
GAGGGGGACGGAAAACTTAAATTGTTNATCTCGGGGGTCACTAAGGAGNAAGGGAAACCC
GGATGAATAGTGATTGCATTGNGGNACACTATANGATAAGGAAAAACAACTCCTCCCCCC
CCCCGCCTAAAGGAAAAGAGAGAGGAGGAGGGGGGAGATATTTTATCAGTAGCTCNTGAC
AAANNAGTGGCGCAGACGAGGAGGGATATTTGTTATGATTTTAAGTCATANGAGAGNGAG
ATACACCCCCCCCCACCCCTAACACAN
Quality >S03036-02_C20.phd
8 5 5 3 2 4 6 7 7 3 5 5 11 21 14 13 14
14 25 24 13 16 35 20 19 17 9 18 14 24 42 40 22 28
42 37 31 12 24 43 31 30 28 37 43 47 30 32 36 44 37
42 32 49 26 21 43 28 35 49 30 49 28 54 50 49 41 35
28 34 46 50 44 18 50 44 39 44 46 44 33 44 47 49 54
50 54 50 60 57 60 39 33 47 52 33 35 44 47 43 52 52
52 48 43 48 52 57 60 57 57 60 60 52 53 60 57 52 60
60 58 60 57 57 58 63 52 63 63 63 63 63 63 63 63 63
63 63 63 63 63 53 63 60 52 53 60 63 63 58 63 63 63
63 63 63 63 58 63 63 63 58 63 63 63 58 63 63 48 53
58 57 63 63 63 58 63 63 63 63 63 63 63 58 63 63 63
63 58 63 63 63 63 63 63 63 57 52 57 57 63 63 63 63
63 63 63 63 57 53 52 63 60 57 52 58 57 58 60 60 60
60 57 60 57 53 57 60 60 58 53 63 63 63 63 63 63 63
58 52 63 63 63 63 63 58 58 63 63 63 53 57 63 63 52
63 63 63 63 60 63 63 63 63 63 63 63 63 63 63 63 53
52 63 58 63 57 63 63 58 63 57 63 63 63 63 63 54 54
63 58 63 52 54 63 63 63 63 54 63 54 60 58 63 63 58
63 63 63 63 60 60 58 63 63 63 57 58 60 58 60 63 52
57 60 60 63 48 53 52 58 57 52 52 63 58 63 58 63 58
60 54 60 57 60 63 63 63 63 63 52 46 63 58 57 57 63
57 58 63 63 58 58 58 57 60 60 58 58 59 52 63 52 57
57 52 58 57 47 50 60 51 60 50 50 50 54 54 50 57 50
50 50 47 47 47 50 47 47 54 44 44 50 50 60 60 43 32
44 47 60 60 59 60 59 54 50 54 54 42 44 36 11 9 20
18 9 22 17 19 9 44 26 31 19 18 19 16 22 10 16 10
13 14 16 22 10 10 9 10 9 19 13 14 14 12 13 13 12
10 25 14 14 11 16 18 13 13 10 7 12 11 12 10 10 6
9 9 11 16 30 30 13 25 27 32 27 19 20 33 22 14 27
33 20 39 20 25 25 19 10 17 29 21 31 20 6 10 21 22
21 14 9 15 18 18 13 17 13 15 9 12 12 21 19 10 32
29 23 13 16 14 24 34 15 17 13 9 12 9 25 21 9 25
12 22 31 34 17 13 21 22 11 16 11 6 11 16 11 13 11
14 17 30 30 19 21 15 9 25 24 20 9 10 11 12 13 17
13 16 18 30 21 19 14 16 17 14 12 13 14 7 10 13 12
11 20 8 14 18 9 23 17 13 16 12 14 11 12 16 17 13
18 20 15 11 9 18 20 28 15 17 23 15 11 9 6 10 11
9 10 9 9 17 19 19 9 11 9 9 14 26 33 13 11 16
24 8 7 11 11 10 14 12 14 14 9 11 16 9 14 11 11
17 11 17 12 13 16 12 10 11 14 19 13 9 9 10 25 20
9 7 11 12 7 11 15 12 11 17 19 8 9 7 9 10 11
16 20 15 14 46 47 23 14 10 10 8 13 13 12 19 11 10
15 32 32 32 32 23 32 15 13 22 16 15 11 13 13 11 11
27 19 24 14 11 11 11 9 8 9 9 11 26 19 13 17 15
16 27 16 24 15 9 16 10 11 18 14 24 17 19 16 19 19
22 19 11 11 11 14 10 10 14 10 6 10 10 12 11 8 15
17 7 6 14 17 13 16 16 16 14 13 13 11 13 16 14 15
20 21 16 19 18 32 10 10 9 9 10 10 13 16 20 11 18
17 11 14 14 17 16 16 28 13 11 11 22 12 14 6 18 9
9 14 10 7 10 13 13 25 11 12 9 10 13 11 12 12 15
24 19 17 28 19 10 27 11 11 14 19 15 9 11 11 10 7