S03036-02_C21
Seqid S03036-02_C21
Sequence >S03036-02_C21.phd
TNNNNNTNTTNCACCCCNANNCNNNNNGNNGATTGNCGGCCAAATCGGCCGAATTGNTAG
AAGAGGGATAAGAACAGACGAAAACACATTTAAGGGCTATACAAAGATGAATATGGGAGG
CAGTAGCAGCACTGCTGCCAAAAAAAGCGACTTGTAAAATATCGATGTTATGGAATTGGT
ATACCATTGACACCTGCTTCATTGCCAGATCTTGGAGAAATGACACCAAAGGAAAATTTG
CTGGTTCTTGCATCGGTTGTTTTGCGCTTGTGGTGATAGCTCAATGGCTTACTCGTTTTT
CAAGGCAATTTGACGTAGAGCTATTAAAAAGACAGAAAATAANGCATTTNGCGGGGTACG
GGGGGAGAGGAGTATGTTGTTATTTGTGNNGATCANGAAANAAATCTGAGANGGAAGAGC
TGCTATGTTTTTNCAACAAGNCAAAAAAAAAAACAAAATTAGCGTGGGCCNCCGCCCTGG
NCNGGGGGGNANGAGGCNAATGNTTANTTTTAANTATAAATACANNCNNCAAAAATATCA
CTTNAGCGCGGTGCTNNAGTTTAGGAANGGAATGGGNCTTAAACANNGCCTNACCNNNGG
GCCNNCCNNGNAAGGGGGGGAGGNGCGGTGTATANTGNNNAATCCTNNANAACAAAGAAA
ATATATCGAGAAGTGANGTCAGACGCTCNGAAAAGACAGAAAAGAAAAAAANNCCCCCAC
ACCCCGCCCCTGNNTGNGANTAGANGGNAGGGGGGGAATNATGANAGGGCCTTTGACCGA
NAGNATAGGAAATCTNGNAATGGTGGAAAAAANNAANGTGNGANNAANGNTNCNANCNNC
CGCNGGAGACNCNCAAGNCCANAAGGANNATTGGGN
Quality >S03036-02_C21.phd
10 6 5 6 6 6 8 6 10 9 7 9 9 11 8 9 10
6 9 5 5 8 5 7 5 5 6 8 7 5 13 24 18 21
16 6 15 11 14 11 11 11 9 10 22 19 15 18 16 21 12
13 8 16 16 9 5 9 8 9 21 18 19 35 12 13 10 9
9 22 22 22 42 38 24 23 14 31 27 25 31 17 13 13 35
19 31 28 26 35 31 25 18 16 35 11 26 29 25 32 23 35
17 35 25 20 21 14 22 30 23 18 24 32 53 53 35 25 19
35 19 26 24 33 46 35 47 45 20 47 32 39 53 60 53 44
60 53 42 41 46 47 36 35 47 47 41 53 53 48 48 60 57
57 53 57 53 60 57 53 60 52 53 53 53 53 60 53 45 47
45 57 57 57 52 52 53 53 52 57 57 52 52 53 52 52 53
52 52 48 53 53 52 60 57 57 60 60 52 57 53 52 53 53
53 48 40 44 37 35 44 35 45 52 37 53 42 53 53 42 53
53 46 52 41 52 52 24 34 35 42 47 35 35 38 35 19 29
28 38 42 53 53 53 53 53 53 53 53 57 57 53 60 53 27
18 41 38 53 53 53 53 57 52 52 45 52 53 53 52 53 53
53 53 53 30 53 43 23 53 57 53 47 37 53 52 53 45 53
53 53 52 57 57 23 35 42 42 53 53 27 23 14 37 53 27
53 53 53 60 60 53 52 32 40 21 14 9 26 11 16 33 31
24 11 19 12 18 20 16 9 28 31 9 14 16 11 18 23 19
13 10 7 13 19 11 25 9 9 6 13 10 11 11 23 10 9
11 10 10 12 13 18 13 10 13 18 35 12 30 14 19 32 12
10 31 37 23 20 23 11 9 11 8 13 8 9 9 6 7 9
10 16 8 19 5 13 23 9 8 6 14 11 9 9 9 16 17
26 11 13 7 16 16 11 12 11 9 11 12 24 12 17 16 9
9 12 10 17 38 11 9 6 10 10 14 11 11 9 11 6 10
13 14 11 9 28 28 21 53 41 23 11 9 13 19 13 10 9
13 10 9 8 9 11 10 9 10 10 8 6 9 10 9 10 10
11 10 10 10 6 10 6 10 33 23 9 16 9 6 11 6 18
10 14 12 11 6 9 10 9 11 6 10 10 9 6 10 13 13
18 11 11 6 9 14 10 9 11 14 10 19 11 8 6 6 10
6 6 9 28 16 14 13 16 9 9 11 8 10 10 11 12 7
14 10 8 9 12 10 23 9 11 8 9 6 6 11 11 9 9
12 11 12 14 9 18 6 9 11 9 11 11 8 10 9 6 8
10 10 11 14 19 11 23 7 6 8 11 12 9 6 9 18 14
6 6 6 8 8 9 9 11 6 6 11 9 6 6 9 6 8
8 13 14 20 23 20 19 14 9 9 9 6 10 9 9 14 11
9 8 9 9 11 6 11 11 6 6 7 11 9 8 9 11 10
6 6 11 6 18 15 11 12 33 9 11 18 12 19 14 11 9
11 10 9 10 14 10 10 11 10 9 9 8 12 6 9 14 10
8 11 22 11 12 11 8 14 6 8 19 27 17 8 9 16 8
8 8 42 27 12 14 9 9 16 30 35 27 12 8 6 6 19
12 11 14 12 11 11 14 8 18 13 10 9 14 18 14 14 10
11 5 6 8 10 7 18 8 7 9 10 10 9 5 11 12 5
8 14 12 9 9 9 8 11 11 9 12 6 9 12 8 18 6
9 8 10 11 11 11 10 17 9 9 8 9 11 11 12 6 9
11 6 10 9 11 10 11 9 16 14 9 11 10 6 12 6 11
11 9 11 9 10 10 10 9 11 11 10 19 9 6 5 11 10
5 8 9 10 7 8 12 6 5 11 11 5 10 6 11 6 9
7 14 5 10 6 5 8 11 9 9 5 9 9 9 10 9 11
6 10 5 8 10 9 10 6 11 9 9 6 8 9 9 9 11
7 7 8 10 9 14 8 8 5