S03036-02_D02
Seqid S03036-02_D02
Sequence >S03036-02_D02.phd
GGNNNNNNNTNNTNTGCNCCCNNNNNANGGCGAATTGGCGGCCAAATCGGCCGAATTGAG
GANTAGTTTTACAACCGTAATCGGTCGCAAACTAAAAAACACTTTTGTTCCGTCCATGAT
GTTAACTAGCGTAGCTGGTAACGATATTTTTTTCCGAGGTTTATTCAAATCGCCGGTATT
AGCATTTCAAAGTTATCGTTATGTTTCGATTTTGGGACAATTGAAACCGTCCGATGGTTC
TACAAAGTCTTTCAAAAGACTTGGGCGTGGTCCTTCCAGCGGTTTAGGTAAGACATCAGG
GCGTGGTCAAAAGGGTCAAAAGGCGCGTGGTAAAGTAAAATCGTGGTTTGAAGGTGGTCA
AACTCCAATTTACAAGCTATTTCCTAAAATTGGATTTACCAACGTTGGCGCCAAACCATT
AAAGGAATTAAACTTGAAACGCATTCAATGGNTTCATGATAAAAATAGGCTTCATTTGCA
NCCAGGCGAGGTTTTAGACATGAATAAGATGAGAAAGCTTGGTCTGGTAACTGGTCNCAT
AAAGTACCGGAGTTAANANTGTAGCTNNAGGAAAGATACACAAAAAAGTNGCGATTGCTT
TTTGAGNNGAGTAGGAANAACCNNGGGNCCTATTGGGNNTATTNAANAAGAGGGGGGGCA
CATTNCAGGATTGTGACGGCCCTATTGTAGGNNCAAAAGAAACATAAAAAANNAGAAGCT
AAAANCCTCCCNNAAATGNGGACAANAACCAGTGNAAGGCGNGTCACGTTNNAATANGGT
GGNTGNNANAAAAAATANANAAAAANNTGCNNNGGGGTTGGTTGGATAANGTNAGNAAAA
NGGNANAGCGACCCNCTNAGACCAANNNAGNGGATAGGGAGNNCNAGAANNAAGTNNNAN
Quality >S03036-02_D02.phd
25 8 6 5 4 3 3 6 7 8 3 5 9 7 10 12 11
5 13 11 12 5 3 3 5 5 8 6 23 16 10 27 18 17
17 35 31 16 11 30 21 16 24 9 11 12 30 30 40 25 31
24 36 31 14 33 30 27 14 21 12 8 7 9 42 40 46 51
51 34 28 33 31 35 43 35 35 31 35 49 49 35 32 29 32
43 42 46 35 46 46 38 38 32 27 26 26 26 35 42 43 42
43 50 46 46 49 42 32 43 39 44 42 46 44 38 54 44 42
50 54 50 44 50 51 45 45 44 50 54 50 50 50 50 54 50
50 50 50 54 39 45 43 51 54 54 52 51 57 57 51 51 51
54 51 54 57 50 54 50 53 50 54 52 53 57 54 49 57 57
57 50 54 54 54 57 50 54 44 57 50 54 57 57 57 59 57
54 59 57 57 57 57 50 57 57 57 57 57 53 49 51 57 54
50 54 52 50 54 51 54 54 54 54 57 57 45 50 49 54 54
59 59 50 54 54 50 50 50 42 43 44 42 44 39 49 42 25
27 20 30 36 43 33 39 44 50 57 57 57 57 57 54 59 54
54 54 54 54 54 57 57 57 57 50 50 54 54 57 54 54 57
54 54 54 54 50 50 54 57 57 57 54 57 50 54 50 57 50
51 54 54 54 50 54 54 54 54 50 51 49 54 54 54 50 50
46 49 50 50 50 54 54 54 44 54 54 50 54 49 49 49 50
44 42 44 54 54 49 49 49 59 54 49 44 46 42 43 43 46
43 44 34 43 49 43 43 49 49 49 44 44 46 45 39 49 39
27 32 28 43 49 49 54 54 44 50 50 54 59 50 49 54 39
32 42 46 44 38 30 44 46 43 38 43 30 27 24 33 46 49
46 42 17 12 43 44 39 46 46 29 29 46 50 50 50 50 54
43 39 42 35 18 35 39 36 42 39 43 38 27 25 42 46 44
44 44 42 43 26 32 42 42 46 43 42 25 12 25 31 25 31
31 35 35 25 12 33 35 28 12 6 16 35 47 31 47 42 39
24 12 15 24 19 22 22 17 21 24 27 29 42 47 12 26 19
35 33 20 10 7 12 20 13 21 42 13 11 14 12 19 17 17
16 22 22 16 17 24 44 36 31 34 35 35 29 35 29 46 31
34 29 25 46 31 27 20 42 42 18 22 17 17 35 22 42 46
23 25 26 30 28 28 35 8 12 6 11 20 32 25 16 22 28
19 24 22 13 10 12 13 9 13 18 15 16 7 9 6 12 9
15 28 19 23 11 6 6 9 24 22 41 24 28 9 13 10 12
10 20 11 11 22 11 13 9 11 9 10 6 10 9 11 13 12
29 33 31 14 18 14 9 12 11 16 9 6 7 11 9 9 9
10 11 9 9 11 6 22 13 9 10 6 6 11 9 11 6 10
9 11 15 10 11 13 11 9 6 7 12 15 14 10 6 8 11
6 12 16 10 10 9 10 16 9 10 11 9 9 11 11 9 19
9 6 8 14 37 8 9 13 9 11 9 9 29 9 9 10 21
11 9 11 8 10 10 10 12 11 11 11 7 6 11 8 12 20
21 10 9 9 13 9 9 8 10 10 20 26 14 37 6 6 10
9 8 11 11 10 11 11 9 12 18 6 12 13 9 11 9 9
6 7 9 14 10 11 14 7 10 9 9 9 9 9 6 15 10
11 9 9 11 10 11 6 11 10 10 14 9 9 6 9 13 14
9 9 11 11 10 6 6 9 11 11 12 6 13 10 11 14 8
6 9 10 6 6 9 6 9 11 12 9 24 28 8 18 7 10
7 9 14 13 12 10 6 6 9 10 8 6 6 6 9 9 8
14 9 9 11 11 10 9 10 8 8 14 12 10 6 9 10 6
10 9 7 24 9 12 14 6 9 10 6 9 7 10 10 10 11
14 8 8 10 6 9 11 5 8 9 9 8 18 13 23 7 6
6 10 10 6 10 8 11 9 10 10 18 16 9 9 5 7 8
6 11 15 12 10 6 6 10 11 9 11 6 7 7 11 5