S03036-02_D03
Seqid S03036-02_D03
Sequence >S03036-02_D03.phd
NNNNNNNNNNNNNTNNGGNCNANNNNNNNNGGCGATTGGCGGCCAAATCGGCCGAATGAC
CACATCGACAATGTTACGCACTACTAGACTATGGACCACCCGCATGCCCACTGTGAGCAA
ATTGTTTTTGAGAAACAGCTCCGGCAATGCCCTAAACAAGAATAAACTACCATTTTTGTA
CTCATCCCAAGGACCTCAAGCCGTGAGGTACACTTCCCAACATGAGTGGATAGCTGTGCA
TCAGGACAAGACTGCCTTTGTCGGAATTACAAAATACGCCACTGATGCCTTAGGGGACGC
TACCTATGTTGAGTTGCCAGAAGTGGGCACTGAGATTGCCCAAGGTGAGTCGCTAGGGTC
CATTGAGTCCGTCAAGTCAGCCTCCGAGATCTACCAGCCTGCCGATGGTACCGTAGAGGA
AATTAACACTAATCTTGAGGAAAATCCAGGTGTGGTGAACGAAGATCCTATGGGTGACGG
CTGGCTAGTCAAAATGAAGCTTGGTGAGGGCGTTAATGTGGAACAGGTCGAGGGTCTAAT
GNCNTAGAACAGGACGAAAAGACACTGGNTCATGATGACTGANCAAAGCTTTATACGTAC
NTAAAGTAATATCATNGATATGTNTATATATGGTAGGNGAAATTNAACATTGAANNCAAA
GTAGACACTTCAAAAAAGGGAAAGAAAAAGGAGGGGAAAAAAACAATAAAAAANGCAAAA
AAAAACCGAGAAAAGACCNAAACATCCNATCCTAGGGGNAAAATNAAAAGAGAATTAAGG
GATATGGAGANGAGATNANGAAAGAAAATTANGGAGAAAANTAGAAGNNTAAAAGTAAAA
GAANAGNAGAACAAAATAANCATNNAAAAGGGGGGANAAAAATAGGAAGANATTGGGGAC
GGAAAGGNGGGACTANGAANT
Quality >S03036-02_D03.phd
7 3 2 2 2 4 4 4 3 3 3 7 6 9 7 7 9
10 7 8 7 9 7 5 5 5 3 5 5 7 24 14 9 16
13 16 42 26 9 9 29 28 17 24 12 10 20 40 37 42 32
36 31 31 24 11 31 31 15 13 23 21 30 26 38 35 31 32
35 17 36 46 49 46 32 35 35 36 42 42 42 42 46 46 42
42 38 42 42 43 42 52 52 50 23 42 42 32 43 54 54 43
41 41 37 54 35 34 36 32 29 27 42 30 42 41 43 37 35
43 46 47 54 50 50 49 49 53 49 49 54 54 50 43 42 50
43 54 50 50 49 54 42 41 54 43 54 54 50 50 59 54 42
54 54 53 46 46 53 49 51 50 50 49 49 49 50 54 54 54
42 42 50 53 53 53 53 51 54 54 42 49 50 42 54 57 57
50 50 53 57 57 35 39 53 57 57 49 43 43 53 53 51 49
57 42 38 51 49 36 46 49 42 49 49 57 53 50 35 54 54
42 59 54 52 57 57 53 49 42 31 46 46 31 49 49 54 49
43 35 40 35 35 35 54 42 50 54 49 49 52 50 51 57 54
49 54 57 53 49 54 49 54 54 49 36 43 53 43 49 35 53
53 53 54 54 47 50 54 54 54 54 57 57 42 52 57 49 51
57 54 59 46 57 53 53 42 32 50 43 57 54 54 51 51 54
57 54 54 53 51 57 59 54 57 50 42 49 49 54 57 53 46
54 54 54 57 54 54 42 57 49 51 50 42 33 49 46 54 51
50 32 49 49 49 43 49 49 54 54 50 42 42 50 54 42 57
42 54 54 49 46 50 57 54 54 54 54 54 50 50 59 54 46
54 54 49 54 38 54 54 49 49 43 40 35 42 26 44 35 54
54 46 46 49 43 54 54 54 54 42 35 49 54 57 36 49 49
36 54 46 49 49 54 54 33 44 32 45 23 31 40 32 49 43
54 54 38 54 50 35 49 54 49 46 51 46 31 27 43 23 17
41 46 35 46 49 46 38 54 35 54 43 36 50 36 54 49 43
35 35 35 30 36 46 27 31 40 35 43 40 32 23 31 43 46
30 31 14 46 32 43 54 47 19 54 36 37 43 36 30 30 33
43 39 39 38 45 39 33 22 42 39 31 39 42 46 20 20 15
34 14 31 32 35 39 33 23 21 17 26 33 42 27 13 12 19
37 24 10 13 29 42 32 26 37 42 25 21 26 43 6 12 7
8 18 18 12 9 9 11 15 11 22 31 22 35 35 22 44 32
35 36 25 35 36 16 11 7 13 14 8 12 30 28 11 24 21
22 24 35 22 5 14 11 42 24 22 22 20 27 12 15 12 9
19 11 12 22 16 5 9 14 26 25 24 14 16 18 9 9 9
20 16 13 6 8 9 9 12 9 12 9 7 19 17 9 11 14
12 14 13 26 11 22 14 9 7 10 41 36 46 16 8 6 11
35 16 16 9 9 8 14 18 6 7 11 13 16 13 10 11 10
9 11 32 26 18 11 34 8 11 15 20 19 19 8 19 12 12
19 20 11 9 19 24 14 10 32 10 9 11 18 23 9 10 10
12 16 12 11 15 15 10 13 17 14 18 10 19 26 33 11 6
14 10 15 24 11 17 19 17 13 11 13 8 12 9 10 11 11
14 11 11 11 9 11 9 6 13 28 18 15 10 13 9 11 7
8 9 10 8 11 11 10 11 12 11 7 11 9 10 12 13 7
8 9 9 9 8 11 10 16 14 17 13 9 15 8 13 11 10
9 12 10 11 8 21 16 12 7 10 28 19 11 11 7 11 6
13 12 9 10 10 10 14 11 12 11 11 11 7 11 10 9 8
9 11 11 10 6 11 11 14 10 14 10 7 7 10 14 11 16
18 18 11 10 10 14 11 14 14 13 7 9 9 6 9 11 14
13 10 12 21 12 28 15 18 14 6 9 9 11 6 6 16 28
15 13 13 10 9 8 10 9 9 6 9 16 15 11 17 15 14
9 14 18 25 15 12 6 11 9 9 8 9 13 12 11 10 11
9 14 11 10 9 9 6 10 10 12 12 10 11 11 6 11 11
11 6 8