S03036-02_D04
Seqid S03036-02_D04
Sequence >S03036-02_D04.phd
GGGGNTCNNNTTTTTNNGGNNGCCCNNNTNNGGNGATTGGNGGCCAAATCGGCCGAATTG
AGGGGCAAATTGGACAGATGTCTCCACGCGGCAAAATGGAAACAGCAGTTTCACAAGGAC
AACACAAACAACTTAAAGATGGTCACCAGCATAAGGGAAGAAAACTCTCCGAGGAGATCG
CTTCTCTATTGAGGCTCAAAGAGTGCAGGAGGCTCAATCCTGCTAGTTACTATACTCCAC
GTAGAACATCGCAGTCACAATCTCTCAGTGGATCAACTTTTAAAGAGTATAACGAGTACG
TCAATGAGAAAGATTCAAGCAGAGCGCAGCGTCAAAACGCTGCCGCCGTTTTAAGCAAGC
TCGCCCATGACTTTTGGGAGAACGACTGTGTCATTGACGAAGACATATTCGAAGATTCGT
CTGACGAAGAACAATCATGATTGCATCTCTTAATCGTTACACATACATACCTTCTACCTC
TGTACTGTTACATATGCATTGACTTTACGATCTAATATAAATCCTTTTGATGTTAAAAAA
NNAAAAAGCNGCAGGACAAAGCATTATGNAAAAAAAGAAAAAGAAAGNAAAAAACAGTCN
CGGNNANNGGGGGCNGNGNTGGGTTTCATAGTTGTCCTTAATANCTNNNNGTAATCAGGG
NCATACTAGNNCCGGGTTAATNNATTTGGTTAAGANGGGTGAGATAAAAAACAAGNAAAA
CCACAGGTAAANNACNGAGGCAGAAGGTGTNATAGTATCTNTTAGNGNATTGAGNNNTNG
NGGAGAAAGNGNGNNGNTTTGNAGNGAANACAAGTAAANGGAGCAANACACANNGANCNG
TAGNTANGAACNNNNNAGANGAAANGNNGGGANGAGAATAATGNNAAAA
Quality >S03036-02_D04.phd
29 18 12 12 6 8 8 6 5 6 12 8 9 9 9 7 7
13 8 3 5 9 10 10 10 5 5 6 11 5 5 18 26 7
27 25 21 35 23 8 7 20 16 11 14 8 9 16 35 28 35
28 30 30 27 21 15 42 27 15 8 8 13 23 27 23 31 30
29 47 42 32 26 24 12 35 36 39 31 46 43 43 43 46 42
18 32 19 32 35 42 38 37 33 35 25 33 36 21 27 30 31
54 32 42 42 36 39 42 42 39 39 31 42 36 39 42 50 34
44 42 60 47 44 42 44 47 47 47 44 60 60 49 47 42 44
44 44 42 44 54 50 54 57 46 52 52 52 47 52 60 59 52
60 52 58 60 57 60 52 57 52 57 52 52 57 57 54 60 60
52 52 52 57 48 46 52 52 52 47 52 57 63 58 52 52 52
52 58 58 63 52 52 52 52 52 57 57 57 60 58 63 58 60
52 52 60 52 60 52 52 52 52 54 60 60 52 57 57 60 60
57 52 54 54 59 60 52 57 52 52 52 57 60 46 40 47 42
34 32 40 30 18 21 27 30 28 18 32 47 60 54 60 54 54
57 47 60 46 57 60 57 57 63 58 52 52 57 52 63 60 52
52 53 57 60 57 60 60 60 52 57 57 57 60 58 57 60 52
52 57 57 52 57 60 60 57 59 52 52 63 52 57 52 58 57
52 40 48 60 57 57 52 46 57 57 57 57 60 60 60 57 58
52 59 54 57 60 47 57 57 52 57 57 60 60 52 52 52 52
52 60 57 57 57 52 60 60 57 57 57 52 57 52 57 57 47
47 57 52 57 57 52 42 35 37 48 52 52 52 52 60 60 57
60 57 57 52 63 46 58 52 35 57 52 52 63 60 58 57 57
57 47 52 58 57 52 52 40 53 52 42 52 42 52 57 60 57
60 60 42 60 57 52 52 32 57 57 47 40 48 57 60 52 37
40 52 52 57 57 48 57 52 48 43 48 57 57 60 52 42 46
57 60 42 52 41 35 40 42 40 40 43 60 48 35 48 48 43
39 60 52 52 52 60 57 42 48 40 57 60 60 60 57 47 57
57 60 57 52 52 48 30 37 40 60 47 20 29 37 37 41 39
35 35 35 35 29 60 60 43 32 47 60 48 34 42 42 35 60
41 35 11 9 10 13 32 57 52 57 60 47 37 35 35 48 47
34 47 47 42 47 37 35 14 19 13 11 15 9 6 6 9 9
9 9 9 9 9 6 8 9 9 11 14 18 11 9 10 22 10
8 10 10 8 12 8 9 7 19 17 13 11 14 14 8 8 14
13 31 32 14 9 13 11 11 11 7 12 12 41 30 17 23 11
9 9 19 9 6 13 12 11 6 6 8 6 6 9 14 31 12
9 11 7 9 6 10 7 9 12 13 8 9 13 18 19 12 16
14 11 9 9 9 10 16 13 9 9 12 21 11 9 6 10 19
6 6 6 7 9 9 24 23 10 11 9 9 15 9 6 9 13
10 10 9 14 9 9 7 6 9 12 27 21 17 8 9 13 28
10 7 7 9 9 10 9 10 11 10 9 10 10 13 12 7 10
9 20 9 11 16 9 12 9 22 13 10 13 13 16 9 10 8
10 6 14 22 9 8 8 9 14 12 10 12 16 8 8 8 9
6 6 14 9 6 11 11 9 11 10 16 10 16 11 11 9 10
10 8 6 9 9 10 10 12 8 10 9 13 6 11 9 9 9
7 9 6 21 10 9 11 14 18 7 6 6 9 6 17 6 9
9 12 22 14 9 8 9 7 9 6 18 6 6 9 6 9 9
11 11 7 15 12 7 11 10 9 6 28 11 15 16 14 9 11
21 12 6 11 8 12 12 11 12 16 6 9 11 24 10 14 6
6 9 9 6 10 7 13 17 16 9 6 9 12 6 9 11 8
9 7 7 6 7 5 12 9 9 6 10 13 9 11 6 12 6
6 8 8 11 12 6 8 9 8 19 9 10 10 11 9 11 6
6 9 15 13 12