S03036-01_B23
Seqid S03036-01_B23
Sequence >S03036-01_B23.phd
NNNNNNNNNNNNTNNNNNNNNNCNNNNANNGNNGATTGACGGCCTNTCGGCCNANTTTNN
NTATTAGATATAAAAGAACCATAGTCTTNAGTAATCATTCAAAATGCCAAAGAAGAGAGC
TTCCAACGGTAGAAACAAGAAAGGTAGAGGTCACGTCAAACCAGTCAGATGTGTCAACTG
TTCCAAGTCTATTCCAAAGGATAAGGCTATCAAGAGAATGGCTATCAGAAACATTGTTGA
AGCCGCTGCCGTCAGAGATTTGTCCGAAGCTTCTGTCTACCCTGAATACGCTTTGCCAAA
GACTTACAACAAGTTACACTACTGTGTTTCTTGTGCTATTCACGCCAGAATTGTCAGAGT
CAGATCCAGAGAAGACAGAAAGAACAGAGCTCCACCTCAAAGACCAAGATTCAACAGAGA
AAACAAGGTTTCCCCTGCTGATGCCGCCAAGAAGGCTTTATAACCTGNTTAATANAGGTG
ANACATAAGTNGGTTTTTCTGCTATTTCTAATCAATANAAAATAACCATTACCNAGNAGA
GGNGGGAGGGGGGGNGAAGGGAATAAAAAAAAAAAGAAGANAGGCGTAAGGGCCCCCTTN
CNATTGGGGGGGGGNGGGAGAGAGAGGGGNNTNANATCTTGTNNCCTTTGNNTCAAAAGA
GGNGGAGGGTNNAGAGGGNGGTTGGGTGGGTTTTGTTGGTTTNAGGNAAAAAGGAGANGG
ACCCATCCCCCCCCCTTCTCNGGGGGGGGGGGGGGGGGGGGAGGGGACTTTTGANGGATT
CNTGNCGAGGGTGCAAAGTGTGGTGGGGGGGGNGNGGGAGGCGGGCANTGGNNATGTGGN
GGGAAANACCAGNGNACCNNGCGCGGCCCNNNNN
Quality >S03036-01_B23.phd
5 2 4 4 3 5 4 2 5 3 3 5 8 6 7 7 5
7 7 5 5 5 12 5 7 5 3 8 5 5 9 7 6 11
17 10 13 16 9 14 10 13 9 12 10 5 15 10 9 9 11
15 6 9 6 9 8 15 6 7 6 15 16 15 10 16 16 16
11 9 16 15 20 25 35 15 32 14 18 39 23 24 23 10 13
33 11 9 7 10 9 31 25 13 22 28 14 16 16 22 10 11
11 22 13 37 19 11 13 9 13 22 26 18 16 32 57 42 42
41 32 32 37 26 18 28 42 11 19 17 21 16 21 18 23 45
24 36 35 45 24 53 47 52 60 45 46 52 52 52 60 57 53
52 58 63 57 60 52 52 52 48 42 52 47 52 42 52 52 52
60 52 46 42 40 37 32 34 35 34 48 43 40 33 20 46 35
35 40 43 60 48 33 34 43 32 53 43 37 60 48 44 57 47
18 22 22 32 35 30 30 19 18 27 35 26 16 19 21 21 28
37 46 35 37 47 22 16 22 18 16 18 12 16 30 30 14 12
18 16 11 17 16 20 30 30 35 52 43 26 26 33 34 37 27
52 18 31 42 57 53 40 48 41 52 52 63 63 29 53 42 57
60 47 57 57 57 52 25 42 52 60 57 58 48 35 32 40 22
11 8 18 40 35 52 46 54 20 32 48 60 52 41 60 60 22
57 35 34 35 22 33 35 48 43 42 57 39 57 60 47 52 42
48 35 52 34 25 23 41 26 60 60 35 43 43 26 30 35 29
30 11 43 27 43 16 9 28 19 21 20 21 16 22 20 16 21
25 14 14 14 18 22 47 30 18 24 20 26 57 52 52 43 37
48 37 16 48 43 34 23 24 32 18 23 24 18 20 18 34 48
34 43 22 48 48 57 60 48 33 48 42 52 42 57 47 30 41
48 29 57 52 32 52 52 32 16 15 16 52 52 52 35 35 18
26 32 43 29 48 43 35 35 43 43 24 43 43 43 48 45 39
35 20 35 29 39 45 13 35 15 14 13 10 39 36 53 34 29
20 35 29 35 25 8 12 13 6 11 20 25 17 16 11 6 9
27 42 19 34 13 6 8 13 11 13 14 12 23 11 6 11 11
9 11 11 10 9 13 11 9 19 12 26 16 11 27 16 19 11
23 19 18 11 29 22 9 7 21 36 24 19 15 13 35 23 23
19 31 26 9 18 12 6 9 8 6 11 11 10 11 24 7 27
19 26 16 18 34 27 20 22 10 9 6 13 19 9 16 11 14
11 27 14 10 18 9 13 13 21 18 14 12 18 16 9 11 9
9 16 7 9 9 9 10 10 9 11 8 9 11 11 23 27 10
12 18 9 11 6 9 6 10 10 9 9 10 14 8 18 11 28
16 11 7 10 14 8 13 14 10 10 10 10 9 15 28 11 9
6 6 10 6 8 7 15 14 8 10 10 9 9 6 6 11 9
9 9 9 11 6 6 9 11 11 11 18 10 10 10 13 14 6
10 11 8 9 9 12 9 6 6 11 8 13 16 13 9 6 9
9 8 11 12 11 13 10 9 14 9 10 10 8 9 12 10 10
18 13 10 15 14 6 8 10 9 6 10 14 13 17 14 9 11
10 10 9 7 18 13 14 15 14 9 9 8 11 11 28 9 9
8 14 31 9 8 9 9 9 19 6 15 10 12 17 25 23 12
10 8 14 20 22 14 18 13 14 10 19 11 9 12 20 20 14
13 10 9 11 9 12 10 14 14 7 15 13 9 11 10 9 7
9 11 6 9 16 10 11 20 14 11 30 9 16 10 14 33 10
11 10 12 13 9 9 10 11 10 16 14 9 9 7 8 6 10
10 10 11 12 13 16 16 14 17 11 9 6 9 14 9 6 6
9 9 16 10 16 9 6 14 12 12 11 18 11 7 11 10 10
11 11 7 9 6 8 10 11 6 6 8 11 9 13 14 10 10
12 9 6 6 6 7 6