S03036-02_D07
Seqid S03036-02_D07
Sequence >S03036-02_D07.phd
NNNNACNNNTANNNNNGATTGGCGGCCAATCGGCCGANTTGAGCGATAAATGCTATAATA
TAATCAAAATTTAGCAAGGATACATAGCAGCAAACCCGAACTTTTAGGCCTTTCATAGAT
GAAGAAAATTTCTACAATTCTTTTGGTTCTTTGGCTCTTCAAATATGAATTTATTAAGAG
GAAATCCTGAAGCATCAGGACATCGCAAACTTTTTATTCGCAAGAGGATTTATCCTCTGA
TTAGTTATATATGAATATGTGTTCCTTCTGCATGATTTTGATATCAATAGTATGCATTTT
TTTTCGATTCGTCGTAGAAACATAACTACTCTCATGACTAAATGACTTTTTTTGGTTTTG
ACAGTGGAACAGCCAAGTTTTTATGTAGAAATNTATTATNTGTTNGCTGGAAATAATGTC
TTAGGACCATGAAACATTANCCCTCTCNTATAACCGGGAGGAAGAAGGAAAACNTAATAA
TTAATTATCCGTTNTTAAGGNANTCNAAGAAGATCCGNNGGGGGGCNTAATTAATTGTTT
NAATAATTAAAAAAAAAAAAATNGNCCAACCCATTTCCGAGANAGAGNNAAGNGNGGGGA
TATNATAATTTTTTTNAAAAGTANNNGAAAGANAGAAGGCNTAGGAGTAGTATATAAANT
TATAAAANNTAAAGAAAGAAANCNNACTATCCCAACAATTNAAGANNTTANGCGAAAANA
GAAGGGNANNTNNAAGATATNNNGGAGAGTTAAGNNCTNTATTTCCNCCGGANNGGGAGG
CTNAAATNGTTNAGNCNAGANAGNCCCCNCCNNCGACCGNCAANCGANNCAGTANNNTAA
NCACTANATNNAATAANNAATTGAGGANGATNTAGGTNAANANGCAAAA
Quality >S03036-02_D07.phd
5 3 4 6 9 9 5 7 7 8 16 6 5 3 5 5 9
8 8 15 18 9 8 15 21 15 11 9 11 32 31 27 25 29
31 28 36 6 14 26 26 19 21 27 28 30 11 22 25 28 32
30 32 37 39 39 39 39 42 42 44 44 44 38 46 22 34 34
28 35 47 46 46 46 42 35 20 35 43 30 31 37 60 29 42
35 45 45 45 42 53 39 39 53 45 45 52 53 53 53 52 57
60 57 52 52 52 52 52 57 57 63 57 52 53 57 52 53 48
52 57 57 53 60 57 57 57 52 52 60 57 57 58 60 63 52
57 57 63 57 57 60 57 60 59 52 52 57 57 57 60 57 58
58 52 63 63 63 63 63 52 57 63 60 63 63 57 58 58 58
63 53 57 52 52 57 63 63 63 63 63 63 63 52 52 57 60
60 60 52 53 57 60 57 57 57 57 57 63 52 57 60 52 60
53 53 60 53 57 57 60 53 53 60 53 60 52 57 52 33 53
53 53 53 52 52 60 52 46 60 58 57 57 57 57 60 57 57
57 52 52 52 52 57 60 63 57 57 57 57 57 58 52 58 57
57 60 63 53 57 63 63 58 63 60 63 63 60 53 52 60 60
57 60 58 52 58 60 57 52 52 57 57 52 52 52 60 60 52
52 60 57 52 53 57 57 52 57 60 57 60 57 57 60 60 53
52 53 53 52 45 53 57 53 53 43 29 43 53 53 60 28 53
45 47 53 53 53 57 57 53 53 53 45 53 44 53 39 45 52
57 45 53 53 53 45 53 53 57 57 57 53 53 53 48 37 43
29 24 28 39 39 29 24 53 45 32 53 52 53 36 27 37 37
29 53 53 45 34 23 12 9 23 18 32 26 35 53 44 22 9
23 6 16 16 23 27 33 10 7 10 46 33 9 5 8 13 27
16 35 12 15 13 23 9 19 13 34 14 14 19 19 23 11 19
9 31 20 8 8 9 27 16 14 10 10 15 11 11 6 10 11
9 11 9 9 10 6 11 11 11 11 10 9 13 13 9 9 16
19 12 11 10 9 9 10 12 9 15 10 9 11 13 6 8 9
11 10 12 10 14 9 11 10 13 14 9 20 21 10 9 11 11
6 11 11 12 12 14 12 6 11 7 15 12 7 10 9 11 11
13 11 10 11 8 9 10 6 7 10 12 32 19 14 10 9 6
10 14 17 15 14 8 11 11 14 16 11 16 9 6 9 12 10
9 23 14 11 12 12 11 18 17 11 10 17 17 20 14 25 8
9 7 9 6 13 10 9 9 11 13 14 13 9 9 9 14 10
11 14 11 13 6 8 11 12 11 6 6 11 10 10 6 14 7
11 11 14 13 11 11 11 9 6 9 11 15 14 13 10 11 10
12 12 8 6 14 9 10 10 17 11 20 6 6 6 9 21 12
13 12 8 7 15 11 13 20 11 9 8 6 9 10 19 11 14
14 11 13 10 16 10 11 18 19 19 20 14 6 9 10 9 9
9 16 11 11 6 7 9 9 9 11 10 19 20 17 9 18 22
14 7 10 6 6 9 9 10 9 10 9 9 24 14 10 10 9
15 14 10 7 10 8 13 9 6 6 11 11 10 7 9 8 9
14 9 10 12 6 9 10 18 15 11 11 9 7 9 6 6 11
6 6 10 11 8 14 9 9 14 6 6 6 13 13 10 11 28
8 9 9 9 10 10 6 6 10 11 6 12 8 8 9 13 11
11 6 11 11 10 19 9 6 6 9 23 11 11 10 22 10 10
6 11 10 11 9 6 9 9 11 6 10 9 6 11 6 25 11
10 7 10 19 6 8 9 9 18 6 8 11 7 6 10 9 9
10 12 11 6 14 13 9 6 10 10 10 6 6 9 9 12 9
11 6 6 6 8 8 12 6 9 11 9 11 11 6 9 9 7
6 11 10 11 10 8 6 6 10 11 11 8 10 14 9 12 11
6 9 14 10 6 11 9 10 11 8 6 12 14 7 9 6 10
8 9 9 14 9