S03036-02_D08
Seqid S03036-02_D08
Sequence >S03036-02_D08.phd
TNNNNNTTTTNNNNNNNCTCCCCNNNNGGCGATTGGCGGCCAATCGGCCGAATTTTGGAG
AGTAAGAAACCACAAGAACCCGCCATGTCTAACGTTGTTCAAGCTCGTGACAATTCCCAA
GTTTTTGGTGTTGCTAGAATTTACGCTTCTTTCAACGATACTTTCGTTCATGTTACCGAT
TTATCTGGTAAGGAAACCATCGCCAGAGTTACTGGTGGTATGAAGGTTAAGGCTGATAGA
GATGAATCTTCTCCATACGCTGCTATGTTGGCTGCCCAAGATGTTGCCGCTGATTGTAAG
GAAGTCGGTATCACTGCCGTTCTCGTAACGATCAAAGCTACCTTTGGTACTAAAACCAAG
ACTCCTGGTACTTGTGGTCCAGCTGGATTGAGAGATTTGGCCACATCGGGTTTGAGAATT
GGCCNTGACGACNGCGTTACCCTAGTNCGATCTCGCTCNNCANAACAGCAAGGAGGTAGA
AGAGGNAGGNNNAAGNTATTTAATTTNTATTTTTATAACATAANAAAAAGGAAGANGAAA
AAAGTNAAAAATATGNNTATGAAAATTAANNAGNAAAGAATAGANTAAGAAACATANCTC
GNGANAGCNANAGTAATAAGGTATNTTTANAAACAANTAANTAAAATAGAANTAGTNGTA
GNACGNNANCNAACTCATATNNNGGGCGCANNNGAAGTAANAAGANTANCAAANAATNGA
CAAAGGTATNANTGNNCGAGNGAGNTATTNNANAANAAANANAAAAANNTTAACACANTN
GAGACAANNAGCGCAAANAGANNNCTNNNTNNNNACTTCGNNNGCGCCNTAGNNGATNGA
TTATGTTNACAGNNTACNNNATCCNTACNTAAGNNAN
Quality >S03036-02_D08.phd
8 5 5 5 6 6 8 10 8 8 5 5 5 7 3 5 5
8 10 15 9 10 9 7 7 7 6 26 25 11 21 24 19 31
30 13 13 28 29 15 18 11 21 31 33 40 29 40 34 31 31
18 26 40 28 26 30 21 35 26 41 30 28 16 16 16 27 19
39 18 32 29 29 24 22 17 36 21 28 28 28 35 39 23 13
24 42 28 29 39 46 42 28 22 29 29 33 25 20 29 23 29
44 46 46 46 47 35 47 46 24 12 10 18 60 47 47 41 28
24 36 39 41 41 47 41 46 33 33 46 31 24 24 22 46 23
19 29 41 41 53 47 37 38 20 32 34 42 36 26 39 29 28
19 28 53 23 42 36 53 45 47 47 42 41 27 41 39 41 25
45 45 47 33 36 41 47 25 46 31 53 53 36 53 41 47 63
57 23 36 36 33 45 33 41 39 39 35 30 46 46 23 34 33
26 39 46 13 28 36 36 53 44 35 35 26 42 35 24 24 24
41 44 34 27 40 26 38 23 23 26 44 13 22 40 34 22 22
19 24 24 26 10 23 33 28 31 42 35 27 22 21 27 35 18
29 31 13 11 20 14 32 26 41 20 28 42 57 31 28 23 46
44 35 26 15 22 27 16 14 28 16 28 22 32 19 18 32 19
22 35 13 12 18 41 32 32 15 13 10 32 13 19 13 14 45
13 12 19 46 22 16 11 12 32 40 19 13 10 10 32 13 11
13 11 19 9 9 10 9 37 42 19 32 13 23 27 23 34 53
53 13 10 11 18 53 53 28 19 12 10 20 13 24 24 14 13
23 31 13 45 47 23 42 41 10 23 19 19 11 14 13 14 18
40 23 9 24 35 8 11 12 40 24 16 9 10 13 13 13 41
53 47 9 8 20 13 9 9 8 10 10 10 15 45 33 24 25
34 12 24 15 9 24 16 9 37 11 16 46 53 14 8 11 6
10 14 13 10 13 20 12 7 11 8 10 28 11 26 32 14 15
11 9 9 10 7 18 8 11 11 11 14 8 9 11 18 10 6
6 12 9 6 8 25 13 19 8 9 13 12 14 11 11 24 13
15 14 14 11 20 10 12 9 11 6 19 27 10 7 6 6 22
8 9 6 8 9 10 13 24 12 11 10 10 12 7 12 14 14
19 14 14 14 33 10 19 11 9 22 11 11 19 7 10 14 22
16 11 10 12 11 11 11 10 7 11 14 11 14 13 10 11 9
9 6 11 15 14 9 26 10 10 8 9 6 6 10 12 13 8
8 9 26 19 9 11 12 10 6 6 10 13 6 9 11 14 10
13 9 8 11 14 12 6 9 9 9 8 9 14 18 16 11 9
11 6 9 10 14 11 6 9 8 7 16 11 9 6 23 7 10
11 9 13 19 11 14 20 16 19 11 11 9 7 10 8 11 19
7 18 11 9 11 11 12 7 9 9 16 6 9 11 11 13 11
25 22 13 14 11 7 9 10 10 11 6 12 14 12 16 6 9
9 11 7 6 8 6 8 7 8 16 8 18 9 9 16 16 11
6 5 6 11 8 9 9 10 10 9 6 7 6 16 14 9 10
9 14 17 7 9 11 9 9 7 8 19 7 12 18 9 22 7
8 9 8 6 11 11 10 9 9 11 8 15 9 10 13 6 13
6 10 15 6 7 9 12 11 10 5 13 16 13 6 9 10 8
9 6 5 8 6 9 23 6 14 9 9 6 11 7 10 8 16
11 9 6 6 8 8 8 10 10 13 9 18 6 9 6 13 11
8 17 14 14 14 6 5 11 10 11 9 9 8 11 10 7 12
16 13 5 5 7 11 18 5 5 5 14 6 5 5 5 10 10
11 8 8 11 6 5 6 9 9 18 11 11 6 8 12 10 5
5 15 11 11 5 13 8 9 10 8 14 11 9 9 6 40 12
25 9 7 5 8 11 11 5 5 7 10 9 11 10 6 10 14
8 5 8 15 8 12 5 7 11 5