S03036-02_D12
Seqid S03036-02_D12
Sequence >S03036-02_D12.phd
NNNNNNNNNNNGGGGGCGAATTGNCGGCCAAATCGGCCGAATTGAGAGAACAAGAGAGCA
GGAACGCAAAGAGTGTGTGACACGAAATTCAAGATACAAGAATAAAAGCTTACGTTGTGT
ATTTCAACTGGTGTGCTAAGAATAGAGTTTCATAAAGTACTGCATATATACATATATTAT
TTTTGTTATTTGTATATATACTTCACACTTAGAGTTCTACTAAAAGTCTACCTAGCACGC
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTACCGGCCATAAGGGCCAG
CTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCC
TGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTG
TAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCC
CGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGG
GNGAGNCGGNTTGCGTATTGGGNGCTATTCAGATTCCNCGCTCGCNGACTTGAGGCGCTG
GGACGGGGGGCTGCAGGNANCATANNAGCCGCATTCNAAGGGGGTANTAGNGGGATACCA
CAGAAACANGCTAAAACGAGTGGTCTNNAGAAANNTAAAATGACAACCAANAACCCACGG
CACCGNGAGAGGAGNGGGGGGGGANNANATTATAGNAAGAAANTACCGCACTTACTNAAA
ACAATAANGNNAAAACAAAATNNNAGGAGGGACAAATAAAAAGAAAANAAAAANAACACA
AANCACANNAGAGATGGAACCGNGGNGAGNNAAGGGAAANNAANAAAATANATNNGAAAA
AATGAATTNGAGNGC
Quality >S03036-02_D12.phd
7 5 3 4 3 2 5 7 5 6 7 9 8 19 25 32 10
25 19 24 13 32 21 5 8 30 17 14 24 10 10 22 31 48
40 22 35 50 42 42 28 28 35 25 27 23 35 35 43 41 30
47 42 43 54 32 49 42 50 42 35 46 44 44 34 44 54 60
50 60 44 57 46 48 48 48 48 48 52 42 47 47 52 39 47
60 52 52 60 52 53 52 53 52 52 53 53 53 53 60 52 52
52 60 60 60 52 52 52 60 52 57 52 52 57 57 60 57 53
57 57 58 57 60 52 52 52 57 60 58 58 60 63 63 63 63
58 63 63 57 63 63 58 63 60 53 53 53 63 63 63 63 63
57 53 57 53 58 58 53 53 63 58 60 63 63 63 63 63 63
63 63 63 63 63 63 63 63 63 63 63 63 63 63 63 63 63
63 63 63 63 63 57 57 60 60 60 60 60 57 58 60 60 53
57 57 63 63 58 52 63 57 53 53 57 57 57 57 57 52 52
57 60 60 53 53 60 57 53 57 52 60 52 53 53 52 57 52
58 63 57 57 60 57 60 60 57 60 60 60 63 58 58 60 58
57 60 57 57 59 63 63 60 57 57 60 63 63 63 63 63 63
63 60 57 57 60 57 53 42 45 53 42 53 53 53 53 53 53
41 47 42 60 57 53 52 54 52 52 40 42 53 53 53 53 42
53 53 53 60 60 53 41 35 42 34 42 37 53 38 33 53 53
53 53 60 47 41 35 35 44 53 53 60 53 53 53 53 53 46
53 53 47 37 53 53 53 57 53 53 53 53 53 53 53 53 60
57 57 60 53 53 35 53 53 53 60 60 57 57 52 53 53 53
53 53 57 53 53 53 53 53 53 53 52 53 52 53 53 43 44
60 60 60 57 53 39 44 60 57 53 42 53 47 53 53 45 42
52 60 60 53 53 53 60 60 60 45 42 35 34 52 57 57 52
53 60 44 53 63 57 53 45 53 53 60 57 60 52 53 52 45
47 53 57 43 19 44 53 53 53 45 45 42 45 35 53 57 47
47 42 44 44 45 53 57 60 60 53 45 31 31 35 42 45 45
53 57 53 45 42 42 41 57 57 46 35 23 20 46 47 46 47
35 24 30 57 46 41 41 41 41 37 47 35 42 47 39 42 35
19 35 39 41 41 35 35 19 20 20 30 30 35 18 15 35 35
22 20 20 21 48 37 30 19 25 42 35 19 16 13 5 11 15
11 5 8 23 8 7 13 31 44 21 14 9 10 14 16 41 24
37 7 11 10 32 9 16 16 13 9 12 10 22 16 28 11 7
9 14 22 20 16 8 10 7 12 11 16 18 10 9 11 9 12
12 16 11 16 11 17 18 11 8 16 8 9 10 19 17 11 25
29 11 10 14 11 6 9 6 11 13 11 9 6 6 8 10 11
9 10 9 23 10 13 10 6 13 13 11 20 10 19 11 11 11
7 11 32 8 6 14 9 11 13 11 12 18 24 18 20 14 10
42 14 13 11 12 7 11 10 11 18 12 10 16 17 11 14 10
14 12 10 10 8 10 6 6 9 11 10 9 14 7 6 8 19
28 9 9 9 13 9 12 42 18 11 13 24 13 7 10 14 11
24 28 19 11 10 9 9 8 9 14 11 6 8 13 10 11 28
20 10 11 6 24 18 16 11 11 12 13 9 9 7 6 11 6
10 9 8 9 9 13 12 6 16 16 8 9 16 11 6 10 11
11 9 11 14 11 11 20 9 10 13 11 6 11 18 25 11 11
9 9 9 9 41 7 9 6 6 9 23 13 9 9 10 10 24
11 8 6 6 6 10 9 10 9 18 23 28 9 9 13 12 11
11 10 12 31 9 24 18 9 20 20 11 6 11 11 9 11 17
6 9 13 10 9 10 12 12 14 6 9 15 10 10 6 7 14
10 10 9 10 9 10 10 11 11 11 9 11 6 9 9 7 9
11 10 6 6 9 11 10 12 12 10 9 9 6 6 10 9 6
11 22 12 14 9 14 6 14 11 6 6 10 19 14 16 11 12
11 11 9 11 9 9 9 6 9 9 11 6 11 9