S03036-02_D13
Seqid S03036-02_D13
Sequence >S03036-02_D13.phd
GNNNNNNNNTTTTTTGGNNNNCNCNANAGGGCGATTGGCGGCCAAATCGGCCGAATTCCC
ATGGGGATCCGATATCAAGCTTGGGCCCGGTATGTCGAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAGTACCGGCCATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAA
TAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAAT
TCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAG
CTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTG
CCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTC
TTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCCGCGAGCGGTATC
AGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGNATAACGCGGGNGANNA
CNTNGGAACNAAAGGCCATAAAAGANCGGGATTTTAAAAAAGNCGAAANGAAGCNAATNA
CATAGNCTGAANAGCGATTAGGNCAANATTNATTTAAANGCNAAGCAANAATTTGCAAAC
ACGAGAATGGGCACGAGCCGTGGTGANGATTGANGNAATAAAGAACAGTGCTCANNGGGG
GTAGGCGGNNAGTATGGGANAATNATCTTATTCNTAGTNGGGTANAAATTNNNNGTNNTT
CTNTNNNNNNTGNTNGNGGGGTNTTNGAGNNNCNCATNNNANTANNTTTGTTGNNTTTNA
TTTNNNTGTCNGNGGGAGCTNTCCAAAANGNNNNNNN
Quality >S03036-02_D13.phd
21 7 5 5 3 6 6 6 6 8 12 8 8 10 13 18 17
5 6 5 5 8 6 9 7 8 5 9 8 26 23 8 28 26
15 43 30 13 13 29 26 17 19 8 18 21 35 32 47 34 36
37 36 41 9 29 35 27 22 26 21 35 42 46 35 42 18 16
35 43 46 44 30 43 32 29 32 41 40 46 50 50 42 46 35
45 46 50 54 50 44 42 44 54 47 50 44 47 60 50 59 54
60 60 60 60 57 60 57 60 60 57 57 60 60 60 52 52 60
60 60 57 60 60 57 60 60 60 57 57 60 60 29 22 33 34
46 46 42 42 46 41 37 29 43 60 47 60 52 52 57 52 60
52 48 47 52 34 20 27 35 46 46 42 37 39 39 45 39 45
53 53 57 60 52 52 35 43 60 53 53 53 53 53 53 45 52
52 52 53 47 52 53 53 57 46 53 60 60 48 60 60 57 52
60 53 45 53 53 60 53 57 45 36 53 39 39 53 53 57 60
60 57 60 60 60 52 57 57 60 53 53 53 52 57 53 53 53
57 60 60 60 52 42 60 47 53 53 53 53 39 60 60 57 53
52 53 57 60 53 47 53 57 53 57 45 60 53 60 60 53 53
52 60 57 60 53 57 57 60 53 60 57 57 57 53 52 52 48
57 57 57 53 57 52 47 60 60 45 53 52 52 53 53 45 53
45 52 60 60 57 57 60 60 47 52 42 37 37 60 60 57 47
42 52 52 52 47 52 52 57 60 57 47 42 42 47 60 57 57
52 47 47 60 57 60 60 57 60 57 52 52 47 40 48 60 52
42 47 57 52 52 52 60 57 57 60 60 60 52 52 57 60 52
60 57 52 52 57 57 52 52 52 52 43 52 46 60 60 60 60
60 46 32 31 16 52 52 40 35 47 46 52 60 57 57 42 42
52 42 57 57 57 57 48 31 31 33 40 40 41 40 32 33 29
35 48 40 40 35 33 37 28 23 48 60 47 35 35 40 46 35
29 29 35 35 40 35 47 35 47 47 48 52 57 35 57 23 10
12 15 15 18 20 28 17 13 8 13 15 30 35 34 28 23 8
15 35 39 39 31 31 19 22 16 19 16 18 22 11 14 35 21
34 25 42 42 46 46 46 46 44 57 23 52 32 42 28 46 47
37 18 11 11 11 18 45 16 9 9 16 21 9 7 15 18 14
9 16 20 9 8 13 13 6 9 8 7 7 11 9 6 9 7
9 11 22 15 10 5 16 35 34 20 18 11 24 18 8 10 9
9 8 8 9 6 9 11 11 9 14 11 8 9 14 10 9 19
50 28 10 11 6 11 10 11 11 9 6 10 10 9 9 9 6
9 11 9 7 10 15 11 15 10 11 7 11 10 11 10 9 6
9 14 11 10 11 14 13 11 14 9 6 9 8 11 7 13 9
9 6 10 11 10 8 14 16 11 7 9 9 6 11 12 11 13
12 10 6 13 16 19 8 14 11 9 23 19 28 11 19 11 10
11 9 10 10 10 11 11 14 9 9 9 11 19 9 9 11 14
14 16 17 11 10 23 7 11 11 10 10 11 11 7 8 6 13
14 9 18 10 13 9 9 11 9 14 10 12 11 11 9 11 9
7 6 16 11 11 11 16 11 9 11 10 9 19 10 6 6 10
9 9 9 10 9 8 9 11 6 9 10 8 6 9 9 12 13
15 8 10 9 11 6 11 9 11 10 6 11 9 10 12 9 6
9 9 9 10 11 6 6 6 6 11 8 6 6 8 8 9 8
6 11 6 6 6 7 6 6 11 8 6 11 7 14 6 14 11
11 9 9 7 9 8 7 10 11 8 6 6 6 8 6 9 10
10 6 6 6 9 6 9 9 6 7 11 8 9 10 10 8 10
6 6 9 11 9 6 9 9 10 10 6 6 6 8 9 8 11
6 11 7 9 11 10 10 8 8 8 6 11 9 11 18 8 8
10 6 9 6 6 6 6 6 6 6