S03036-02_D14
Seqid S03036-02_D14
Sequence >S03036-02_D14.phd
NNNNNNAAAANGGGCNNTTGNNGGCCAATCGGCCGAATTTGAACCCAGTGGAGCTATTAG
AAAAATATGGCATTCCTGGTAGAAAATTAGGCGAAGGAGCTTCCGGTTCGGTGTCCGTAG
TAGAAAGAACAGACGGCAAGTTATTTGCTTGCAAAATGTTCAGAAAACCACACTTAAACA
ATGAAGGAACTAATCAGTCTCAATTAGCTAATTATTCTAAAAAGGTTACCACTGAATTTT
GTATTGGTTCCACACTGCACCACGAAAATATCATTGAAACCCTAGATATGTTGACTGAAG
GTGACACCTATTTATTAGTAATGGAGTATGCGCCATATGATTTTTTTAATCTCGTCATGA
GTAACCTAATGACACAAGATGAAGTCAACTGTTACTTCAAGCAGCTGTGCCACGGCGTTA
ATTACCTGCACTCCATGGGCTTAGCTCATAGGGATTTAAAATTAGNCAATTGTGTCGTCA
CTAAAGGATGGTTNNTTGAAACTGATAAACTTAGGNANCGCTGAAANAGTTCCAATTACC
NTTACCAGGATANCATGGNAAAGTAACAAGAAAANCCTCACCCNNAAATANTATATNGCG
GATGAGGAAATAAAATAAAATCCTAATAAACCAAAAGAAACAAAAGNAANCAGTCGGAGG
GGNATGGAGAAAAGGNNANACCTTATGAAGANNATAAANACAAAATATCAAGGGAATAAA
AAGGCAGGGTAAANAAGANACNNAGAGAAGGGAGGACNTAAAAAGAATAGAGGGANNGGN
GGTTGTTAGGTAAAAATCATACAGAGGTACAGATNNGANGAAGTAAGCGTGGGTGCCAGA
TTAAAANAAGAAGANGAAGGATGTGGAGNAGCAAANTNTCAANNTGTGNNATANAANGNG
TGAGTTCN
Quality >S03036-02_D14.phd
6 5 5 5 6 7 9 8 9 9 7 13 32 25 8 7 6
10 14 10 5 5 21 12 15 24 27 12 24 42 40 18 41 51
50 42 18 38 51 29 23 23 26 46 50 30 15 35 41 52 49
47 38 42 43 46 38 40 38 38 49 42 42 42 29 38 38 34
47 44 60 44 41 54 57 60 52 57 52 47 52 60 57 57 57
42 48 57 52 47 52 46 46 57 47 35 58 52 60 52 57 57
57 57 57 53 52 52 52 46 52 52 52 60 60 52 52 60 57
52 52 52 60 57 60 60 60 57 52 52 52 60 52 52 57 52
57 57 60 57 60 53 60 63 63 57 52 52 57 60 52 60 57
57 60 57 52 63 63 58 58 52 58 63 60 57 54 53 58 57
63 60 58 60 58 57 57 57 57 52 60 63 63 57 60 52 57
52 54 52 52 52 60 57 52 52 60 57 60 57 57 53 53 57
52 52 57 54 52 52 57 52 52 57 52 60 60 52 53 53 41
41 35 45 52 47 45 53 48 48 48 48 52 53 52 57 52 63
63 58 63 60 58 63 60 63 52 57 57 63 57 46 63 60 63
58 63 57 59 63 63 53 60 57 63 60 60 52 58 57 58 57
60 54 57 60 52 57 59 59 60 59 57 60 48 48 57 57 53
58 57 57 57 58 54 60 63 63 57 57 52 52 63 52 54 60
52 57 52 57 52 57 52 57 52 52 52 52 57 57 57 57 57
47 60 34 47 40 34 52 52 52 57 60 52 52 57 57 52 52
34 57 60 60 57 57 52 52 48 52 57 60 59 52 47 52 42
60 57 47 47 47 42 52 52 57 59 60 47 57 60 52 57 47
52 57 57 52 52 44 46 54 60 47 57 57 60 48 52 52 57
47 60 57 57 48 48 60 42 34 57 52 41 47 46 52 57 47
47 52 52 52 47 40 40 26 40 40 35 34 35 41 42 35 35
31 27 40 35 40 28 30 35 18 10 23 47 20 18 40 42 42
47 27 30 34 28 24 28 32 20 30 27 21 22 22 11 9 16
22 28 29 9 8 8 6 18 16 23 16 13 15 18 14 9 26
32 16 28 16 17 24 19 17 32 9 8 17 17 26 16 8 11
6 6 13 35 28 19 30 18 11 11 9 22 8 8 9 18 12
12 14 9 14 22 7 16 6 11 9 18 13 10 10 9 24 6
10 11 11 24 10 10 10 16 12 10 18 11 11 7 17 39 41
29 14 12 12 11 11 11 15 6 12 27 10 10 9 6 16 28
19 10 9 11 13 11 9 12 18 10 10 12 11 7 18 11 11
11 11 8 15 9 6 6 9 9 9 10 11 6 14 11 13 11
15 7 10 11 8 8 9 10 15 15 10 12 9 12 13 8 12
13 24 11 11 11 20 23 11 14 13 11 11 19 13 9 15 16
14 16 24 20 9 15 18 10 11 20 12 10 23 10 15 11 10
7 8 11 6 9 10 15 8 11 11 9 11 10 8 11 9 7
15 14 14 8 8 10 9 13 35 9 12 10 6 7 15 7 9
9 12 9 10 8 9 10 8 16 11 9 6 7 10 13 13 22
24 7 10 10 11 11 15 10 9 8 8 9 9 19 10 9 13
10 9 11 9 10 12 11 8 11 12 10 10 19 19 11 10 11
8 8 6 9 9 9 10 6 11 11 6 7 11 11 10 9 9
15 14 14 8 10 10 16 9 11 6 9 28 20 23 11 11 14
10 9 14 10 11 16 11 19 11 14 6 6 11 10 7 9 10
11 13 9 22 17 11 9 9 11 21 12 19 14 12 13 8 10
9 17 10 11 10 10 9 9 11 15 13 12 11 13 11 6 6
9 10 6 10 11 12 9 11 23 23 11 10 10 8 9 11 10
10 11 13 10 12 14 14 9 10 9 30 10 15 6 11 10 13
13 11 11 19 6 11 11 11 11 9 10 18 9 8 8 10 12
8 6 9 9 9 19 14 14 6 11 6 14 9 8 9 6 6
10 11 9 10 6 6 12 11 8 6 12 10 6 10 7 9 8
9 9 9 11 11 11 6