S03036-02_D15
Seqid S03036-02_D15
Sequence >S03036-02_D15.phd
NNNNNNNNNNTNNTTTTAGGNNCNNNNNATNNNGNGATTGGCGGCCAAATCGGCCGAATT
GGACGAGGATGGACTGCAAGATATTGGTGTTAGGCGCAGGTGGTCTAGGATGCGAAATCC
TGAAGAATTTGACAATGTTAAGCTTTGTTAAACAGGTTCATATTGTAGATATAGACACAA
TCGAGCTAACCAACCTTAATAGACAATTTCTTTTTTGTGATGAGGACATAGGCAAACCGA
AAGCTCAAGTGGCGGCCCAGTATGTAAACACGCGGTTCCCTCAATTGGAAGTTGTGGCTC
ACGTACAGGACCTGACCACTTTGCCCCCGAGCTTCTACAAAGACTTCCAGTTCATAATCT
CGGGGCTGGACGCCATTGAACCTCGTCGCTTCATCAACGAGACTCTCGTGAAGCTTACCT
TGGAGTCCAATTATGAAATTTGCATCCCGTTCATAGATGGTGGAACAGAGGGGCTCAAGG
GACATGTAAAAACAATCATTCCAGGCATCACTGCATGCTGGGAGTGCTCCATTGATACNT
TGCCCTCGCAGCAGGATACTGTGCCANTGTGTACGATCGCCAACAATNCTAGCTGCCTTG
ANCNTGNTGNGGAGGANGGGNCAGGGGGNNGNTANCATTTTTTATANAATGNTNTTTACG
AGANATAAAGAAATACTGCTGGACAAATGGTNGAGAAAAGGNAANGAANATANAATCCCA
AAACCACTCNCAACCCCCCCACGCCNAAGGGTGGCGGNAAAAGAAAANATTNNAATAAAT
TTAAAATTAACAAAANNATAGAAAANAAAAACAATNNCNNTAAATAGCGTNAAANGAAAA
AGAGAAACANCNCCNTTNNNGNTNNCGGGNGGGNNGGGGGGGNAGNGNAGGGTTGTGGTT
TTGAANNGAATNAATN
Quality >S03036-02_D15.phd
6 5 5 3 3 7 6 6 5 7 10 7 5 9 18 16 9
12 12 8 3 7 12 6 6 5 7 7 8 9 7 5 5 9
6 17 17 17 29 24 13 11 24 24 20 21 16 16 31 34 32
30 28 36 32 30 34 22 28 30 25 13 16 13 18 42 36 36
23 12 34 32 24 16 34 41 30 34 49 35 25 18 42 29 37
46 27 28 35 41 33 35 35 41 41 27 35 27 15 35 29 32
33 35 42 38 38 49 40 30 24 35 38 34 42 39 42 42 50
42 42 43 44 42 39 50 39 41 54 46 46 44 42 42 42 46
49 49 44 39 42 42 50 54 49 45 49 54 41 59 59 54 50
50 49 51 50 54 51 50 50 51 51 57 54 54 59 42 45 54
54 54 44 57 45 54 54 59 43 46 49 50 46 50 49 49 50
54 54 50 50 50 53 53 50 49 50 57 57 51 57 54 57 57
54 57 57 51 51 50 54 54 49 49 49 54 54 50 54 50 44
54 54 44 59 44 50 43 54 50 50 50 43 39 46 42 44 43
42 42 39 32 42 39 40 42 42 39 47 50 63 58 50 54 45
50 54 49 60 42 47 54 51 53 54 43 46 46 54 59 57 49
51 51 51 51 53 51 57 57 51 51 49 49 54 57 57 59 50
54 54 54 54 50 50 54 45 44 54 54 50 45 51 49 54 54
54 54 57 45 42 54 54 54 45 50 51 59 54 57 57 57 57
57 57 54 54 54 52 57 50 49 49 50 54 50 54 54 42 54
54 54 50 49 49 50 50 44 36 46 43 49 50 46 49 42 42
43 43 39 42 54 50 49 44 44 46 50 50 45 44 59 54 44
50 50 57 54 57 54 54 54 50 49 46 46 43 39 44 49 50
50 42 49 46 46 46 49 50 57 50 50 54 54 49 49 43 42
42 49 51 49 47 60 50 54 50 50 60 60 49 50 50 50 42
47 60 60 42 47 60 63 54 50 49 42 43 43 47 51 60 47
47 47 54 50 47 38 43 40 47 60 60 47 49 28 44 44 47
47 44 47 27 33 32 35 35 27 44 14 16 19 24 42 42 32
16 14 19 19 22 28 27 31 34 47 35 29 17 18 34 35 39
29 35 44 42 33 35 44 35 37 33 19 44 40 52 47 44 47
42 60 39 28 29 42 34 34 44 31 19 25 23 16 29 29 22
24 18 18 19 28 42 26 21 20 12 10 7 9 34 42 35 42
29 22 22 15 24 17 13 22 28 35 35 16 12 21 16 9 9
10 13 17 19 9 7 17 41 14 31 28 16 19 9 35 41 11
11 13 9 16 41 26 26 42 9 7 9 9 9 9 27 15 16
32 14 23 23 9 22 6 16 6 19 18 6 14 29 7 46 18
11 11 9 13 7 24 16 27 7 11 10 11 11 9 9 10 6
6 9 6 9 10 6 11 11 13 8 9 18 40 27 11 9 9
6 9 9 15 10 6 9 6 20 11 20 18 14 10 15 15 11
7 11 10 8 10 21 9 12 20 11 11 10 9 10 14 19 12
16 12 14 10 20 20 9 16 11 10 12 7 10 11 18 20 14
17 12 15 11 7 11 10 6 10 23 11 6 14 10 23 6 16
12 11 10 14 8 10 9 10 11 13 9 10 10 10 9 6 11
9 11 11 12 14 25 13 9 21 10 9 9 15 14 7 9 10
10 12 12 11 9 12 11 11 14 6 9 10 9 10 11 9 11
9 9 7 10 16 12 6 6 11 8 10 9 11 8 14 10 8
19 10 9 9 11 10 9 9 9 10 34 34 9 7 6 10 15
12 9 11 12 9 8 6 19 12 14 19 9 11 13 19 10 6
6 10 6 6 11 10 9 9 10 15 12 9 11 11 6 9 11
13 6 8 9 11 11 17 11 11 10 11 9 10 9 10 11 6
8 6 9 8 6 8 8 7 6 6 11 7 8 7 7 9 10
11 10 6 9 14 8 6 7 8 12 16 13 20 12 11 7 8
8 6 9 6 8 9 8 8 9 8 10 10 9 9 10 11 8
8 10 11 10 6 6 10 10 10 9 6 10 9 10 6