S03036-02_D16
Seqid S03036-02_D16
Sequence >S03036-02_D16.phd
NCCCNNNNANNGGGCGNTTGNNGGCCAAATCGGCCGAATTGATCAATACATATCATAACA
GGTTCTCAAAACTTTTTGTTTTAATAATACTAGTAACAAGAAAAATGACAGTTCCTTATC
TAAATTCAAACAGAAATGTTGCATCATATTTACAATCAAATTCAAGCCAAGAAAAGACTC
TAAAAGAGAGATTTAGCGAAATCTACCCCATCCATGCTCAAGATGTAAGGCAATTCGTCA
AAGAGCATGGAAAAACTAAAATTAGCGATGTTCTATTAGAACAGGTATATGGTGGTATGA
GAGGTATTCCAGGGAGCGTATGGGAAGGTTCCGTTTTGGACCCAGAAGACGGTATTCGTT
TCAGAGGTCGTACGATCGCCGACATTCAAAAGGACCTGCCCAAGGCAAAAGGAAGCTCAC
AACCACTACCAGAAGCTCTCTTTTGGTTATTGCTAACTGGCGAGGTTCCAACTCNAGCGC
AAGTTGAAAACTTATCAGCTGATCTAATGTCAAGATCGGAACTACCTAGTCATGTCGTTC
AACTTTTGGATAATTTACCAAAGGACTTACAACCAATGCCTCAANTCTCCATTGCTGTAA
CTGCGGTTGGGNAGCGAGNNAAAGTTNGCTNNNGGTTAATACTANNCNATATGCAAGGAA
GAAGATTNGAATTATANTATNGNAGATNCAATAGANNGCTAGAANAAATTCNAACTTAGN
GACGCAAGAGGAGANGGGGNGGAACTAATTAAATTTAAATGAAAAATNGAAANAAAANAA
ANNNNAAGGGAAAAAGCTAATGNAGGAGAGTCAGAAGTANNGTNNNAGANATTTNANAGA
NNAACAANCATNGGATGAAAAANGGGNNAGGGTTAATNGTGTTTTAAAAGTGNAANATAN
NNN
Quality >S03036-02_D16.phd
6 16 14 13 5 5 6 7 9 5 3 9 14 23 10 8 7
10 26 12 5 5 15 17 16 24 19 13 31 31 47 40 22 33
52 51 46 12 19 35 23 10 16 27 32 36 44 44 41 28 51
46 44 25 43 49 49 49 34 28 49 39 40 46 49 49 27 10
12 10 10 22 30 50 49 49 50 42 42 40 43 33 42 39 43
35 27 35 39 38 20 30 30 28 35 35 42 35 35 34 35 47
47 47 34 25 35 35 60 42 57 46 57 60 60 43 53 58 58
60 52 57 60 57 53 53 52 52 57 63 58 58 60 63 63 53
63 63 63 63 63 63 63 63 63 58 57 60 58 63 58 58 63
53 63 60 58 54 60 60 63 63 58 54 57 57 60 54 52 58
57 63 60 60 60 58 58 52 60 58 63 60 63 63 63 63 63
63 63 57 48 52 60 53 52 57 57 53 60 60 57 57 59 52
60 57 63 63 53 52 57 60 52 52 60 57 57 52 57 57 57
47 35 20 48 47 34 47 52 52 47 60 60 52 57 57 52 60
57 60 59 59 57 58 60 60 57 52 63 60 63 63 63 63 58
63 58 63 63 63 63 63 63 63 63 63 52 58 57 63 63 63
63 58 60 63 63 63 60 58 59 60 53 59 63 60 52 58 57
58 63 63 52 63 58 57 57 58 63 63 63 63 58 63 52 52
52 58 60 58 57 63 63 63 63 63 58 58 57 57 52 57 57
57 58 60 52 52 52 57 60 52 52 57 60 60 60 63 57 52
46 60 52 52 57 58 57 57 52 47 57 63 60 54 52 63 63
58 63 60 57 57 52 60 63 57 54 59 52 52 57 52 52 57
58 52 60 52 52 60 57 57 52 52 52 57 52 60 58 63 58
52 58 52 52 60 57 63 57 60 52 52 57 52 59 60 57 57
57 57 52 58 58 57 57 57 57 58 60 60 57 60 57 52 57
57 54 57 57 57 57 47 52 52 57 60 60 60 60 60 60 60
57 52 60 52 35 43 57 52 40 35 35 52 52 47 52 60 47
44 49 60 47 41 41 38 33 35 38 42 47 47 54 11 7 11
22 47 47 47 33 15 47 50 47 49 30 25 44 43 38 43 38
29 60 42 42 17 36 33 40 35 29 29 21 21 60 42 57 60
24 31 57 42 36 23 18 18 22 37 57 35 29 29 60 42 52
47 27 34 19 28 42 57 42 47 39 31 43 28 30 32 46 52
30 30 47 35 23 32 29 46 42 19 25 12 27 22 32 34 35
42 12 13 16 11 29 35 19 10 12 8 12 22 11 12 20 16
9 17 15 15 19 11 6 14 14 12 23 9 22 19 21 19 13
9 28 11 12 11 12 13 34 13 9 9 12 14 41 13 9 7
9 9 18 20 16 17 6 7 9 13 28 9 9 9 7 10 10
13 6 7 6 17 11 11 19 12 42 12 9 13 10 10 6 7
11 6 11 13 11 14 9 13 41 28 11 10 12 11 28 20 10
9 10 12 11 6 10 10 9 13 19 16 16 11 6 9 10 9
6 9 6 9 9 32 17 6 9 10 12 15 12 9 13 6 7
10 10 11 12 8 13 11 6 16 14 15 13 13 11 6 9 9
12 18 17 19 9 6 9 11 11 13 10 11 11 9 10 10 10
11 9 9 7 18 12 9 10 6 10 11 9 9 11 11 22 15
9 11 9 12 10 9 9 13 10 15 12 9 11 10 14 12 11
15 9 7 10 11 9 16 7 11 13 19 19 6 10 10 10 6
6 6 6 15 15 16 15 11 15 11 18 10 19 13 12 12 11
13 11 11 6 14 12 9 16 14 11 12 10 8 11 9 12 11
8 14 12 6 6 9 9 6 6 7 10 11 10 7 23 9 8
9 6 9 7 12 9 12 6 7 9 11 11 9 19 7 9 9
9 6 11 9 11 9 10 9 9 9 11 9 7 10 11 9 6
6 10 11 16 9 10 8 23 9 9 6 18 10 11 11 11 9
15 18 15 10 9 14 9 9 6 9 10 6 11 10 9 6 6
6 6