S03036-02_D18
Seqid S03036-02_D18
Sequence >S03036-02_D18.phd
NNNCNNNNNNNNGGGNNNATTGNGCGGCCAAATCGGCCGAATTGATACACAGGGTCAAAG
CTCACAGCACTACTACACTCGTTCAACACTCGTTATATATTATCATGCGTGCCACCACTT
TATTATCTTCAGTCGTTTCTTTGGCATTGTTGTCGAAGGAAGTCTTAGCAACACCTCCAG
CTTGTTTATTGGCCTGTGTTGCGCAAGTCGGCAAATCCTCTTCCACATGTGACTCTTTGA
ATCAAGTCACCTGTTACTGTGAACACGAAAACTCCGCCGTCAAGAAATGTCTAGACTCCA
TCTGCCCAAACAATGACGCTGATGCTGCTTATTCTGCTTTCAAGAGTTCTTGTTCCGAAC
AAAATGCTTCATTGGNANNATTCCAGCAGCAGTGCCTCCTCATCCGCTTCTTCATCCAGC
AAGGCCTCTTCTTCTACCAAGGCTTCTTCCAGTAGCGCTTCCTCCTCTACCAAGGCTTCT
TCCAGTAGCGCTTCCTCCTCTACTAAAGCTTCTTCCAGCAGCGCTGCCCCATCTTCTAGC
AAGGCTTCTTCCACCGAATCCTCTTCTTCCTCTTCTTCTTCCACCAAGGCTCCTTCCANT
GAAGAAGCCTCTTCCACTTATGTCTCTTCGAGCAAGCAAGCTTCCTCCACTANCGAGGCT
CACTCTNCCAGTGCTGNCTCTTCNACCCGTGTCCCAAAAAACAGNCTCCTCTGCTCTACC
ACCTNTACCGGCGGGAGTTGNGCTTTTCTCTGAAGGTTTTGGTAATGTTCTAGAAGCAGG
AAAAACCCGTTTTCTTTGCTGCTGTTNCACNAAGTTAGAANNAANTATCAAGAAGTGTAT
TCTCACGGCGCCAGCNNAGCCATCGGGGGGGGATATTGTNAGCTGGTTTATAAGTGAAAA
N
Quality >S03036-02_D18.phd
4 2 6 8 7 5 6 5 6 6 4 3 11 15 9 5 7
3 14 15 27 15 5 8 13 26 17 12 17 10 8 14 31 35
32 18 25 44 37 31 13 24 31 22 10 19 28 26 19 28 28
35 34 41 26 30 25 29 42 36 44 40 30 35 38 30 32 31
36 36 28 25 32 29 35 42 36 35 35 35 35 32 35 31 21
27 32 38 36 42 35 42 29 26 26 26 20 26 26 26 25 39
27 21 26 27 33 22 26 36 43 46 44 50 50 44 42 44 60
63 63 49 43 42 49 50 49 49 54 45 44 54 49 58 45 43
43 43 43 60 63 63 63 63 58 60 63 63 60 54 60 50 60
50 50 49 60 50 63 54 50 49 49 58 63 49 49 60 54 60
60 58 59 52 63 63 63 63 50 63 63 63 63 63 60 60 50
63 63 63 63 63 58 60 49 58 50 57 49 60 58 50 50 49
60 60 54 54 50 49 45 54 54 54 54 54 49 60 47 49 47
49 60 47 35 38 33 43 50 54 50 44 47 54 51 63 63 51
54 50 54 54 54 50 47 60 49 49 50 50 49 58 63 49 50
60 51 60 63 60 63 63 58 49 60 52 60 63 63 63 47 63
63 63 63 60 57 58 58 54 57 54 63 58 58 60 50 42 58
50 63 51 50 54 54 57 60 60 50 50 63 63 63 63 49 53
47 50 53 53 50 50 49 49 49 51 51 49 49 49 49 45 44
50 50 46 44 44 44 49 50 47 50 54 42 44 50 50 49 49
44 42 46 54 50 54 54 50 54 54 50 54 54 52 51 51 49
51 53 42 46 51 51 49 49 50 50 49 49 50 42 44 53 49
14 7 9 6 7 50 38 50 50 50 42 54 54 54 50 54 54
54 54 57 50 53 50 54 57 50 54 54 54 54 54 50 50 54
59 54 54 51 50 43 59 54 50 50 54 54 54 54 54 57 42
54 54 59 54 57 54 59 54 54 54 54 57 33 33 59 59 54
50 54 59 54 49 49 50 50 28 42 40 46 35 43 38 42 39
32 39 49 42 49 49 49 49 35 35 32 28 42 39 42 59 39
39 39 39 39 42 42 40 42 54 54 59 54 47 47 50 49 46
39 40 40 37 42 46 33 46 42 43 50 34 50 54 54 54 54
54 50 49 46 43 37 42 44 54 54 54 54 54 42 54 54 54
49 49 49 32 51 46 46 37 31 35 49 27 54 30 57 54 54
41 54 49 46 46 54 32 31 30 35 35 35 54 54 37 37 36
36 42 35 43 42 27 35 32 32 32 35 27 29 35 30 35 35
30 21 25 28 22 38 43 21 26 26 41 35 27 33 46 27 22
21 17 9 7 8 17 27 31 26 32 24 10 15 21 27 29 26
32 30 32 32 18 30 31 30 28 35 46 32 38 26 38 38 25
25 43 18 28 27 30 18 24 26 32 22 30 28 30 30 30 20
21 19 23 19 21 27 6 15 13 30 30 38 21 44 44 46 31
33 33 10 6 9 11 27 14 20 20 12 21 11 7 10 11 27
24 27 25 7 9 11 11 16 32 30 19 12 13 10 9 16 14
10 22 59 50 23 22 13 7 14 11 17 24 16 31 16 14 34
23 21 18 21 18 18 12 11 11 11 7 10 16 12 20 22 16
11 16 15 11 10 8 10 10 10 7 9 9 10 17 22 22 13
13 17 16 11 20 21 13 14 17 11 12 13 31 11 11 17 19
17 12 11 13 14 11 12 9 35 11 19 27 27 14 17 18 31
19 19 15 12 12 18 12 10 12 17 26 12 11 19 12 23 22
14 25 23 17 38 8 9 6 9 10 9 7 9 9 12 12 9
15 11 10 9 7 6 28 16 7 13 23 9 18 11 10 9 12
13 8 14 15 20 21 15 25 27 11 13 13 19 10 10 11 11
11 9 12 15 9 6 6 12 13 11 11 8 8 9 13 14 18
12 14 10 11 10 9 9 9 10 9 11 12 6 9 19 17 19
17 14 11 14 9 10 20 23 17 13 11 9 14 11 14 16 7