S03036-02_D19
Seqid S03036-02_D19
Sequence >S03036-02_D19.phd
NNNNNNNNNNNGGGCGATTGNCGGCCAAATCGGCCGAATTGACCCTGCTATCTTTTGCCT
ACCATTGGCGAACGTCATCTTATCTAAGTAGTAAGCTGTATATAAAGATATTTGGAGGTT
TTATTGGAATCTCATAGAATTTTCACTTTATCAGAGGTTTATTGACGAAGACTTTCGTGA
GAAGTACAAAGTGAAGAAGTAAAAAACTCAACCGAAATATCAGTTAATATTATGAATACT
TCAGAACTGTCAATAGCTGAGGAAATCGACTACGAAGCTCTTCCATCACATGCTCCGCTA
CATTCCCAGTTACTGGCAGGAGCATTTGCAGGTATAATGGAGCATTCTTTGATGTTTCCA
ATAGATGCTCTGAAAACTCGAGTGCAGGCTGCAGGATTGAATAAAGCTGCCTCTACAGGG
ATGATATCTCAGATATCCAAAATATCTACAATGGACGGTTCNATGGCTTTATGGAAGGGT
GTTCAATNNGNAAANACTGGANGCAGGGCCTGCGCATGCAGAATATTTTGGNACATACGA
GTTGTGCAAAGCTCGCCTGATAANCCCTGAAAAATAAGCAGCAGCATCAACCAATGGAGG
ACGGCACTAGGTNAGTACCATTGGTAANAATTGGGGCAGTATGAATAGATGAGACCTGTG
AAGCCGTTAAACGGACGAATTGGATCANAAAAAAAAACGNAAAGACTCAACAATTNCNNC
GCNNCGAGGGTNGGGAAGAAAGGGCGAGAAGGAGGNAATGGCTGAGGTAAAGAGACATTG
GAGGATAGGAATGACTATCCCCGCGTTAAATGCCTNGGNAGTNNTTAAGNANAAANTACC
CNCANAAAGNCGNANACATACAGGCGTNANAGNNANNNNGANNTGGNAAAAGAGGCGAGN
NGNAAA
Quality >S03036-02_D19.phd
2 3 4 4 6 6 6 4 7 5 3 9 22 14 17 13 8
12 28 22 5 9 42 27 16 17 8 12 27 29 40 40 21 31
47 48 41 14 31 43 31 25 28 40 46 43 52 51 38 41 42
46 51 51 49 49 35 42 46 43 54 43 26 26 50 54 50 42
42 42 50 50 42 44 44 41 34 30 41 21 18 34 44 49 50
47 47 47 50 50 47 60 43 35 52 52 46 52 60 52 57 57
59 57 60 52 52 54 52 52 63 63 58 63 53 60 58 58 52
60 60 52 57 53 60 63 52 58 57 63 63 63 57 54 59 53
57 63 63 58 63 63 63 53 52 58 60 63 58 57 58 53 52
57 63 52 63 58 63 52 58 63 63 63 57 57 57 63 63 52
63 52 63 63 63 63 63 63 63 63 63 63 63 57 63 58 63
58 58 63 63 63 63 52 60 57 58 60 57 63 63 63 63 60
60 58 58 60 57 49 49 49 60 54 50 60 49 60 60 47 40
42 42 60 47 57 57 57 59 52 52 63 63 63 63 63 63 60
63 63 63 58 57 52 63 58 63 63 63 63 57 57 47 60 63
60 63 63 63 63 47 63 63 63 47 50 58 51 63 50 58 63
63 50 63 57 54 63 63 63 63 58 58 50 50 60 58 60 59
54 60 63 60 63 63 51 49 63 51 49 60 54 57 59 60 60
49 47 58 63 63 60 51 58 63 47 60 50 45 60 50 47 60
47 50 60 60 54 54 47 47 47 44 47 50 60 49 47 63 51
49 49 49 49 47 60 49 49 60 54 60 50 47 63 60 47 49
49 44 35 58 49 50 60 50 44 51 50 51 49 60 57 52 57
57 57 57 57 57 46 43 52 57 57 57 57 52 52 52 57 57
60 60 52 60 41 32 57 60 52 60 57 60 52 57 52 52 60
57 57 43 60 60 44 43 60 44 52 43 35 35 25 43 52 29
52 57 52 52 47 52 42 57 27 40 52 35 32 27 57 48 35
42 47 35 60 35 35 30 9 32 29 47 27 12 9 9 43 16
32 19 7 18 28 21 22 33 39 28 28 31 41 46 29 27 32
14 27 22 34 40 28 30 23 11 40 11 6 6 11 7 9 13
11 7 12 29 26 34 10 8 6 9 35 23 19 39 31 46 53
24 45 28 16 16 10 20 28 11 11 20 10 28 12 11 11 21
39 24 60 22 6 11 13 9 16 16 16 18 16 9 11 13 8
16 24 18 14 28 15 10 9 16 11 15 9 13 13 10 8 9
19 27 6 9 17 16 24 27 46 16 16 17 18 9 12 10 9
18 16 8 9 9 9 24 18 8 13 11 11 16 19 16 11 12
18 10 11 11 21 12 9 9 20 11 25 10 11 11 11 9 9
6 11 10 11 18 18 14 9 14 20 17 8 15 14 11 6 11
10 10 23 14 15 10 30 16 8 14 9 36 13 25 17 14 12
16 18 11 13 20 15 10 11 22 27 9 9 8 11 21 19 11
10 14 9 11 16 15 36 12 9 9 10 12 11 18 14 12 11
9 16 22 11 9 9 9 6 14 11 15 10 11 19 13 10 11
11 10 7 10 16 13 9 11 9 12 11 14 13 11 11 8 9
9 6 9 6 6 9 10 9 6 7 11 11 14 11 21 28 10
7 11 9 10 15 8 9 11 11 8 19 18 14 14 13 15 10
10 10 19 11 14 11 11 6 11 10 8 13 8 8 14 10 10
9 10 16 9 16 9 9 10 11 9 13 31 11 14 14 10 19
18 17 14 15 9 13 10 12 17 17 12 10 11 15 10 18 10
10 10 9 9 14 14 10 11 10 19 10 11 11 10 11 8 6
10 9 6 16 11 11 6 7 12 14 11 11 11 7 9 6 10
10 10 6 11 11 11 9 9 6 9 14 6 11 12 9 9 6
9 10 6 9 6 10 14 10 10 9 9 24 8 11 9 11 10
6 9 6 11 10 6 6 10 6 6 6 6 9 9 6 6 9
12 8 7 10 8 9 9 9 11 10 13 10 14 13 10 6 6
10 6 12 18 9