S03036-02_D22
Seqid S03036-02_D22
Sequence >S03036-02_D22.phd
NNNNNNNNNNNNNNNNTTGAGNNNGCCNAATCGGCCGAATTGNNCCCAAGGAAACAGTTC
AAGAGCCAAACTAAAGAAAAGCATATTGCAAAAAATGTTAAGAGAAGTAATCTATTGTGG
AATTTGCTCCTACCCACCAGAGTACTGCGAGTTTTCAGGAAAATTAAAGCGCTGTAAAGT
TTGGTTATCTGAAAACCACGCAGACCTTTATGCAAAGCTATACGGTACTGACGATAATAC
ACAAGAGGTGGAAGCCGTGACCAACAAACTGGCTGAATCCAGTATTGGCGAAGCTAGAGA
GGAAAAGTTGGAAAAGGACTTGCTGAAAATTCAAAAAAAACAGGAAAACAGGGAACAAAG
AGAATTAGCTAAGAAGCTGTCATCGAAAGTGATCATTAAAAGAGAAGCTAGGACCAAGAG
AAAGTTCATCGTCGCCATCTCTGGGCTGGAAGTTTTCGACATCGACATGAAAAAGCTAGC
CAAGACATTTGCGTCTAGGTTCGCCACAGNGTGCTCAGTCTCGAAAAATGCAGAGNNAAA
AGAANAAGTTGTCATTCAAGGTAACGTGAAGGAANNNNCGAATNTTCCACNCATNGGAGN
NGGGGNGAAAATTGATTAAANTATGTTTAAGTGTTAACCAACCNATTCAAAGAAGANNAG
NACGGCTGTTGAATGNGTGGGGGAAAAGAAAAGAGTCANAAACTAAACCAACACGGTTGG
GGGGGAANAGGATGGGNGATGTATAAAAANNCATATGACAATANGAAAAAGGAANTGGGA
NGGTGAGGCNGTCAATTAAAAGATGAAAAGAGGNAAAANNNCGNCCCCCATATGNCCNAC
NNGNNTGGGGGANNGTNNTTGGGTGT
Quality >S03036-02_D22.phd
7 5 6 5 2 6 7 7 7 3 5 5 3 3 3 5 9
9 16 9 11 7 6 5 9 14 10 7 9 15 24 28 28 20
15 27 30 26 16 31 15 10 5 7 16 14 21 22 24 34 28
16 14 10 19 14 21 28 30 21 28 26 31 37 29 27 27 25
25 24 32 36 33 44 44 35 42 30 27 29 27 31 21 26 22
36 42 44 35 31 24 27 21 22 18 23 33 24 22 35 29 35
40 35 42 42 42 46 47 44 52 60 57 60 52 60 48 42 57
47 52 52 52 60 57 52 52 57 60 57 47 60 54 60 48 52
57 52 52 52 52 57 57 52 52 60 57 52 60 52 57 57 60
60 57 52 52 57 60 52 57 60 57 52 57 60 60 52 52 52
52 52 57 57 52 60 60 57 60 60 60 57 60 52 59 52 60
57 57 57 57 57 60 60 57 52 52 47 57 60 57 52 46 52
52 60 57 60 52 60 57 57 46 31 41 35 47 41 40 41 47
35 35 40 52 19 21 20 35 48 34 42 47 52 57 60 57 57
57 60 57 57 54 60 57 52 52 52 57 52 52 52 57 57 53
57 57 57 58 48 52 58 52 63 52 53 60 58 57 60 63 52
57 57 57 57 54 54 57 52 52 60 53 60 57 57 58 54 52
57 58 59 59 59 59 57 57 57 57 53 53 57 58 57 60 60
57 57 57 60 52 57 60 60 57 57 57 52 52 60 60 48 52
57 60 52 60 60 40 52 60 52 41 40 60 57 57 60 60 42
42 35 35 60 47 40 60 40 52 52 57 58 52 52 57 57 57
58 60 57 57 57 52 52 52 57 52 52 57 57 60 60 46 57
57 60 57 57 52 57 60 57 57 57 57 52 52 57 57 52 60
52 36 57 57 52 52 60 60 57 60 60 52 52 52 54 52 52
52 57 57 57 52 46 57 57 57 52 58 52 52 60 60 60 57
60 52 57 57 57 60 57 57 47 57 46 60 60 52 52 57 59
59 54 60 46 40 52 40 35 34 34 35 47 42 40 39 18 30
34 47 39 28 31 34 32 22 18 10 23 29 34 21 28 46 34
39 35 44 31 39 35 44 44 52 42 46 52 42 46 47 21 22
42 28 20 25 29 34 31 32 33 17 19 41 35 47 32 16 7
13 22 40 27 39 27 20 23 28 35 18 18 42 47 46 40 33
26 21 20 12 18 16 37 11 5 6 8 22 16 20 11 41 10
7 13 16 13 19 30 46 17 13 16 23 23 19 20 22 13 28
12 10 28 9 11 11 13 10 11 10 14 19 10 6 6 6 6
10 10 12 10 9 6 14 16 11 18 8 9 7 18 10 22 6
9 16 10 8 6 6 9 20 16 9 7 16 15 20 28 11 10
11 20 10 13 9 11 14 13 7 12 15 11 11 11 9 10 9
9 9 10 11 9 10 10 31 18 16 19 9 9 9 6 9 8
9 11 9 18 9 14 26 11 19 23 7 6 12 9 6 9 8
10 9 10 10 8 10 15 10 14 10 12 9 6 19 9 11 12
9 11 9 11 10 25 10 11 11 13 9 15 9 18 9 9 11
11 6 23 12 9 10 12 9 10 10 11 9 9 13 11 9 11
10 12 11 11 11 13 19 21 10 9 10 16 9 7 10 12 9
9 9 9 9 9 6 11 11 9 11 9 9 8 9 10 11 8
9 6 6 8 9 17 14 14 10 19 10 10 10 9 12 6 10
9 10 18 11 16 9 8 11 10 7 9 11 10 10 10 7 10
11 10 10 9 8 9 9 6 9 9 11 14 14 10 10 11 10
11 16 16 18 8 10 9 9 10 9 19 9 10 12 6 11 9
9 8 6 6 6 9 9 6 14 16 10 16 9 9 11 9 10
9 6 14 10 6 8 9 6 6 9 6 6 11 10 18 23 19
11 8 6 6 10 11 6 6 9 11 11 8 10 11 9 8