S03036-02_D23
Seqid S03036-02_D23
Sequence >S03036-02_D23.phd
GGNNNTNNNNTNTTTCGNNCCNNNNNATAGGGCGATTGGCGGCCAATCGGCCGAATTGAA
GAATATACGGACCATGCGTTTGTTTGAAAATAGTAAAGATATGGAAAACCGGAAGAGATT
GTTACGTGCCAAGAAGGCTGCCGGCAATAACAATTGTTTTGAATGCAAGAGTGTCAATCC
ACAATTTGTTTCTTGCAGCTTTGGCATATTTATATGTGTTAATTGCGCAAACCTTTTGAG
GGGGATGGGTACGAACATATTTTGTGTAAAGTCAATAACAATGGATAATTTTGAAGAAAA
GGATGTCAGAAGAGTAGAGAAAAGCGGAAATAACAGATTCGGTTCCTTCTTGTCCAAAAA
TGGTATTTTGCAGAACGGGCTTCTATTGCGTGAAAAATATGATAATTTGTTTGCTAAAAG
TTACAAGAGGAGGCTGGCCAATGAAGTGCGCAGTAATGATATNAGTCAGAACATGTATTT
GGGATTCAATAATTTCCAGCAGTATACAAACGGTGCGACGAGCCAAATAAGAGATAGGAC
GTTGAGGGAAATATCCTATAACAGCAATGCTTCAGAANGGGCAGAATTTGNACTACCTGC
GACCGCGTCCCCCNCNGAGGAGGGGTGGAGAATGCGAAAGATTTTTCTTTTTTTTTGACT
TACCAAAAAAAAACAAGGGATTATAATATTTTTAAATTTTTTCCCCAAAAAGAAACAAAA
TAAAGAAAAAAGGGTGTTTCTCCCTCCTCCGAGGGGGGAGAGGGGGGGGAGAGGGGGNNT
GNTTTGTGTTTTCGAAAGATAAAAAAAAAAAAATAGGGAAGGATTTTACCTCTTGTGAGA
CCAGAGGAACNGN
Quality >S03036-02_D23.phd
36 11 5 5 6 8 7 5 7 7 8 7 8 28 18 8 9
6 5 9 12 6 6 5 5 5 8 8 11 11 24 15 10 22
26 18 31 40 18 18 32 28 21 19 27 18 43 37 37 29 42
36 31 28 17 31 38 30 20 19 20 31 16 17 36 29 33 46
40 50 31 29 26 30 43 46 40 41 46 46 52 52 52 52 52
43 42 35 46 42 41 42 42 54 38 41 42 39 42 42 52 41
54 54 50 54 50 50 43 49 54 54 44 43 44 54 44 30 30
51 53 52 45 50 42 39 54 60 60 50 50 60 44 44 54 44
50 44 54 54 47 50 54 50 54 54 54 54 47 47 60 49 49
54 59 60 59 60 60 60 54 59 60 50 63 58 60 58 49 58
54 60 57 60 59 54 54 60 57 52 59 60 57 57 60 60 57
60 60 60 57 58 60 60 63 60 59 54 63 63 63 63 63 63
58 59 63 57 57 58 58 63 60 59 59 58 63 63 63 52 57
59 57 63 63 58 52 60 57 60 57 52 57 60 60 60 57 60
54 58 63 58 60 57 48 33 60 60 54 57 52 52 60 57 52
57 60 60 60 54 59 60 57 63 52 63 60 57 57 57 58 60
57 52 60 57 57 57 57 57 60 57 57 57 52 52 52 52 52
60 60 57 57 57 57 60 60 42 40 60 47 57 36 33 47 47
47 47 60 54 54 50 54 60 54 60 50 54 50 51 63 63 60
51 47 43 60 58 49 50 50 54 59 59 50 60 50 44 54 50
47 50 49 47 49 60 54 54 54 60 60 63 47 60 54 47 47
40 60 47 49 51 51 44 50 50 51 51 49 57 54 50 43 49
49 50 49 49 50 54 54 54 54 50 46 50 51 50 44 36 36
42 42 44 38 32 32 42 42 44 42 46 46 46 43 50 54 54
44 42 54 54 50 44 44 54 39 42 39 44 54 42 44 39 44
54 50 49 49 49 49 31 50 30 42 50 42 21 50 33 39 42
43 42 33 19 25 26 35 18 38 18 18 19 33 27 20 27 20
17 19 10 6 9 9 10 21 19 19 37 23 33 29 44 59 23
19 24 23 44 34 37 27 33 29 37 34 30 34 30 22 23 27
33 32 33 24 33 20 27 33 19 26 30 42 42 42 22 24 27
29 18 29 23 30 44 31 38 39 27 39 19 23 31 19 20 29
32 34 22 23 38 14 23 27 42 50 54 42 16 18 14 16 24
32 16 27 34 34 44 42 17 31 21 24 22 8 11 14 20 27
27 14 14 17 12 9 24 17 13 21 21 18 14 16 49 32 7
35 22 31 16 14 18 27 18 20 21 17 9 7 8 17 18 19
20 23 11 11 8 14 11 8 8 14 11 14 12 15 14 11 8
9 7 11 7 11 8 11 15 18 14 16 15 13 16 11 16 12
11 19 11 17 17 13 13 19 27 27 19 29 21 36 26 12 14
11 11 12 25 25 14 11 16 25 19 14 17 11 16 25 19 13
18 14 28 44 21 14 14 21 44 22 11 11 11 11 11 10 11
10 15 9 11 9 13 12 11 11 14 15 14 11 10 15 11 11
14 14 14 18 14 13 14 15 12 17 24 14 14 9 17 24 24
25 19 25 23 25 18 18 18 14 25 18 26 19 13 13 14 11
13 18 11 13 13 11 11 14 19 17 16 18 20 14 24 10 9
10 10 11 9 13 12 14 13 22 9 9 13 17 19 16 14 13
14 19 17 15 20 16 9 10 11 8 14 13 7 6 10 12 7
10 11 19 12 8 10 17 19 19 14 9 16 8 11 14 8 20
11 20 24 32 19 15 27 24 17 14 14 11 11 10 11 11 10
13 10 10 14 12 10 10 12 15 19 26 17 13 11 8 15 16
15 14 12 15 19 28 10 10 10 14 28 13 13 14 11 18 8
6 9 6