S03036-02_D24
Seqid S03036-02_D24
Sequence >S03036-02_D24.phd
NNNNNNNNNNNNNNNNNNNNNNANNNNNCTNACGCNCCNCNNNNNNGGGNNNGNNGGCNN
TTNTNTNNCCNNNNTNNNNNCAAANAAAGANNGGNGAGGNNTTTTTGTTGTATGCACCCC
NTTNNTNNNNNNNTNNNNNNNTNANNNNNNGGNGGGGGGGGGNNGGGGGTTNTTTTTTTT
NTTTTTTTTCTACATATGATTTTGAACGGCGGGAGTTGTTTTGATTTGTTAGTAATACAC
NNNGAACAANNACAANNCCTNCNTGNGANNGTTTNAATAATN
Quality >S03036-02_D24.phd
2 4 7 4 2 4 7 7 2 6 5 5 6 6 3 5 2
2 2 2 4 4 11 5 3 3 2 2 13 15 5 12 11 8
18 5 8 8 7 11 7 7 7 7 7 7 13 9 8 7 7
7 8 5 7 19 8 9 6 6 9 23 7 8 6 10 7 7
11 13 7 6 7 6 8 7 7 6 6 6 9 8 10 12 7
22 27 16 17 13 6 6 10 8 7 11 15 11 9 6 6 11
14 11 15 12 10 14 12 11 10 13 9 9 13 13 12 9 9
12 5 9 9 6 6 10 3 3 3 3 3 5 5 8 5 3
5 6 6 5 7 8 5 8 5 3 5 3 3 5 9 15 6
11 11 21 34 42 19 15 16 10 7 7 9 20 15 9 12 10
12 6 10 9 10 9 11 14 10 11 6 9 12 16 11 14 11
11 9 8 10 13 11 13 14 13 10 9 9 10 10 11 8 11
9 10 11 23 11 9 9 8 10 10 14 12 19 11 9 22 17
20 16 16 10 11 8 14 14 11 12 9 9 10 14 8 8 14
9 8 6 6 6 11 10 11 10 9 9 6 6 8 8 9 8
5 6 14 9 9 6 8 7 10 9 6 10 10 7 6 8 11
9 11 6 9 9 9 9 11 9 6