S03036-02_E01
Seqid S03036-02_E01
Sequence >S03036-02_E01.phd
GNNNNNNNNNTTTTNTGGNNNGNNNNNNNGGGCGATTGGCGGCCAATCGGCCGAATTGAG
AGAAGTGGGGTGAGCAAAGTATAACAACCACGATTATGAGTTCAAGTTCTTATAGGGATT
CATATTTTCAATACCGCCATTTATCAGCACCACATCACATATTATATGCGGAATGGAATC
AAGATATACTGGCGCTTCCGGACGAAGTGGCAAATATTACAATGGCTATGAAAGATAATA
CTCGCACCGACGCGGAGGAGGGAAGAGCTCCCCAAGATGGGGAAAGGAATTCTAATGTAC
GCGAGAGCGCTCAAGGTAAGGCATTAATGACAAGTGAACAAAATAGCAACCGCTACTGGA
ACTCTTTTCATGATGAAGACGATTGGAATCTATTCAATGGCATGGAACTGGAGAGTAATG
GAGTAGTGACGTTTGCTGGACAGGCGTTAGATCATTCTTTAAACGGGGGAACCAATTCCA
GGAACGACGGTGCCAATGAGCCAAGNANNGAACGATAACTGGTTCTATTTTTGATAGGCG
CATCACACAATTGGCGTACGCAAGANANNACGGTNGNCANNAACTGGCTCTCCCACAGTC
ACGATGAGCAGAACGTGACGTATATGCTGATCATTANGTCANNNNTGTGGTGTATNGGTA
CTATGCNACAGNCGNTGNGACTAGACTANTGTGGTGAGANANTTNNNNNTANAGCANANN
NNNGCGGNNNNTGGGCGGNGAGANNNACGNCNAANNNAGGTGTACNTNNNNGATTNCNNN
NAAAANNNANNNNNTCGCGGGNNNNNTNCANNTAATNNTTNNNNNAGTNANANANANAGG
NANNNNTGCGGNNGNGGNGCA
Quality >S03036-02_E01.phd
11 6 5 2 2 4 4 4 3 6 16 23 23 10 5 9 9
13 3 3 3 10 3 3 3 5 6 5 5 8 16 12 17 20
31 11 32 30 10 13 25 36 25 19 34 36 41 31 41 31 35
34 40 32 13 32 32 25 13 13 31 30 32 30 35 36 44 34
41 43 50 52 42 36 46 35 37 40 50 40 41 40 38 35 36
21 25 40 35 36 50 41 42 36 36 35 35 46 52 46 41 32
42 19 28 46 46 43 50 46 42 59 59 42 49 49 51 30 23
54 54 36 54 54 49 49 51 51 31 30 42 43 54 54 49 51
49 57 38 54 51 42 43 49 50 39 46 57 59 50 57 54 51
43 51 52 54 59 49 49 54 49 39 49 54 54 49 51 57 54
54 50 49 41 51 54 50 49 42 59 40 49 57 44 49 57 54
57 53 53 53 57 59 52 49 53 51 51 51 49 53 39 30 40
45 46 39 51 51 50 46 52 49 51 49 49 50 51 49 51 49
52 52 53 51 49 52 52 52 50 50 49 46 49 44 26 49 51
49 51 50 52 52 52 49 49 50 53 50 42 52 41 53 49 49
35 19 52 39 16 53 51 51 51 46 53 35 51 52 49 53 37
46 35 49 49 42 28 49 53 53 49 44 45 42 49 53 38 49
21 53 46 49 52 52 51 52 41 43 43 32 50 52 52 42 52
35 50 42 50 49 43 27 52 46 53 32 40 53 32 50 30 46
42 49 46 53 32 52 50 38 26 50 49 49 49 43 45 39 20
45 45 50 49 46 49 46 32 41 49 50 49 42 50 42 46 50
49 53 45 53 34 49 46 49 46 51 51 42 28 50 49 42 26
49 45 43 37 43 26 46 50 25 49 49 46 37 45 32 51 46
50 42 49 42 16 49 42 51 41 35 36 32 49 49 42 44 36
46 49 51 38 36 51 32 46 36 38 34 49 40 40 36 34 42
32 49 49 41 28 46 32 41 45 43 24 46 46 41 42 30 30
41 49 32 40 33 41 34 28 49 21 34 26 30 46 29 26 41
35 20 22 41 39 20 25 12 15 30 14 15 17 26 15 41 32
49 26 32 19 30 51 19 30 36 28 36 32 18 49 34 32 39
32 10 49 35 42 50 26 46 30 13 24 30 7 8 3 5 8
12 9 20 29 30 27 22 23 26 28 40 35 15 41 46 18 38
11 26 20 19 34 37 28 23 22 11 32 26 34 36 21 49 32
29 30 30 34 23 46 21 51 22 50 38 25 35 28 23 17 49
18 51 24 9 3 13 5 3 12 23 11 30 12 5 9 7 12
10 7 6 10 33 22 19 37 32 21 24 37 29 20 15 15 13
25 20 29 23 18 12 37 31 30 15 15 21 18 24 18 21 13
11 17 9 14 23 13 15 23 30 29 26 20 25 19 31 30 17
8 10 11 12 10 15 10 5 8 10 10 20 3 3 5 3 10
8 10 13 17 10 27 14 14 14 3 13 26 17 12 30 31 12
16 20 23 6 10 12 14 15 7 26 10 3 11 14 7 8 16
19 19 8 10 23 16 18 13 5 9 13 9 28 12 9 13 12
12 16 5 15 6 15 8 5 5 5 7 6 10 10 6 13 8
8 10 5 10 7 3 3 3 7 8 18 12 10 5 5 5 5
10 9 9 8 8 20 14 5 8 11 8 9 6 5 5 8 8
9 6 9 5 9 9 3 5 5 10 9 9 14 9 16 12 10
6 9 7 7 5 7 14 10 10 9 7 9 5 5 3 6 10
13 13 8 3 5 3 8 3 6 5 7 6 11 9 9 12 18
10 9 6 7 6 7 5 11 7 9 9 7 6 17 15 15 8
5 5 8 10 6 5 6 6 7 9 9 14 6 12 7 23 6
8 5 21 6 9 13 12 6 8 5 5 7 6 10 11 11 12
25 5 5 10 6 12 9 6 11 10 14