S03036-02_E05
Seqid S03036-02_E05
Sequence >S03036-02_E05.phd
NNNNNNNNNTGNNNAGNNNNNNNNNNNGGGCGATTGGCGGCCAATCGGCCGAATTGGCAC
TTATATCTTCTTCATGTTTGTCATTTTATTAGAAACTTTACTATTGGAAATAGCGAATCA
ACAACAGCTAACGAACGACTAGGTCTCTAAGAGAAAAAATCTTTTTCTTTTCACAACATG
GAGCAAATATTATATAATCAAAGCCTTAAAATTTCTACCCTTTCTACTTTTCAAGGTTTA
AAGTTTCTAAAGGTCCTCATTTTTTCTATTTTCCAACAACTTTTTTATAACCCAGTTATA
CAATTATTCGGAACGAAAGCCTCAATAATGGAATCTGATTCCACTACTCTGCTCGAAAGT
AGTTGGAGTACTGAGCGAAACTTTCTCAATATGAATCCAGATTCCATATCTGCTAGCAAG
AATGTTTTTATATTATTTTTTACCATTTTCAGATTAGCGGAGTATATTGTATACAAACTC
TCTGACCAGAAGTATCGGTTACACACATCCCTGAATGTCCAACATTTCAGGTGGAATTCG
AAGAAGAATACAAACAGAAAAAGGACACTTTCCTTTAACAAAGCTTACTTACCAAGAACA
AATATACTAGCGATTTGTGGAGGCGATGGACTAAAAAATAGATTNTCAGGCCCGCTAACT
GGTAAGTCCTTGGNANAGTTCCAAGAATCTCAATTTNNAGAGCGANGANAATAANANGCC
GTNNCNNCATNCGGAAGCAAANGNGGGAACAGAGTTTTATGGGTTTAGGTTACTCATAAA
TGGCAGCATAAAAAACAACATAATNCTCNTTTTTCTCTAANATTTTTAAAAGGAAGTGAT
TATAATATNTTTCATTNNNACTGTGNTGTNGGGAAGGGNAGGGTTGNTGGNAGGTTTNTA
TTAGATAAAAAGATNAGG
Quality >S03036-02_E05.phd
6 5 5 5 5 6 6 4 7 9 8 3 5 5 9 8 5
3 5 7 5 5 5 3 3 3 5 9 13 16 9 28 31 14
32 31 15 14 21 24 15 10 9 8 40 31 41 31 36 41 32
34 12 29 34 35 24 19 21 27 38 28 29 29 29 46 37 50
37 43 35 35 18 29 41 52 41 30 32 43 24 27 17 21 31
33 44 43 38 44 44 44 32 30 33 32 35 35 44 36 38 36
38 35 35 43 36 30 29 26 35 44 42 47 47 47 47 44 44
39 35 44 44 47 50 44 47 60 44 42 47 47 60 54 54 50
54 50 47 44 50 54 54 54 50 52 50 45 50 50 49 63 63
63 58 57 60 60 57 52 54 60 60 60 47 47 47 42 60 60
54 54 54 54 47 60 49 50 60 63 58 63 51 49 60 60 60
50 57 57 50 60 54 60 60 49 47 58 63 47 63 63 49 54
60 50 50 54 47 47 47 50 54 60 60 47 49 49 63 60 60
60 52 54 47 54 52 60 60 60 35 27 28 29 52 57 34 36
27 40 40 47 52 57 57 52 54 52 52 63 60 63 63 57 57
60 57 60 57 52 57 60 60 63 58 58 52 57 57 60 60 57
57 52 42 57 58 50 60 60 50 60 63 60 60 47 54 49 47
60 54 60 47 47 47 60 52 60 57 50 50 50 60 54 52 60
50 49 60 50 49 54 50 47 54 60 60 50 54 50 60 54 54
49 63 49 58 50 50 60 50 54 54 47 60 47 47 47 40 44
49 50 44 47 47 40 47 60 60 47 60 47 49 49 60 47 47
38 42 35 27 35 42 60 46 43 49 60 60 47 38 60 60 50
54 60 50 50 49 47 47 60 58 58 42 49 47 47 47 50 60
44 50 49 49 49 54 50 47 60 63 50 54 60 54 54 60 59
54 60 54 50 50 47 42 38 47 50 49 50 44 44 47 58 50
58 60 63 63 60 60 59 54 50 60 50 54 60 54 49 49 60
46 47 44 60 54 60 60 47 50 60 54 44 50 50 60 54 50
49 47 47 42 42 44 44 42 42 49 39 44 42 42 50 27 35
27 42 44 44 35 35 35 42 33 23 26 22 35 42 28 24 28
31 26 24 57 52 35 47 40 35 42 60 46 46 52 52 44 47
36 52 52 47 34 46 52 52 25 57 29 47 47 39 52 57 44
47 22 32 52 47 52 57 52 60 21 57 35 28 39 42 35 32
19 18 40 44 34 39 26 19 35 44 57 44 25 44 52 52 47
47 44 57 36 42 32 20 42 47 39 44 47 22 35 14 16 10
17 26 52 31 22 19 20 18 28 24 18 17 11 28 18 19 11
18 22 19 26 14 22 28 35 28 28 23 20 22 18 13 9 28
23 22 19 19 10 12 20 10 13 19 14 9 26 26 16 29 28
24 13 13 35 18 12 12 30 31 26 12 20 16 11 11 7 9
10 9 9 34 16 23 26 16 36 12 13 8 8 16 29 30 9
34 13 9 10 18 16 19 29 13 10 7 11 7 9 11 9 13
11 12 14 16 16 31 11 8 11 9 9 16 16 20 11 11 7
6 11 9 11 11 13 24 24 6 9 11 7 9 12 19 12 8
6 9 6 9 10 11 15 12 7 7 9 7 6 9 10 11 6
10 9 29 11 16 8 9 8 9 18 6 9 6 10 10 9 10
11 9 9 11 9 11 9 9 10 9 9 9 9 12 14 11 11
9 18 19 10 8 18 16 11 14 10 11 19 14 12 9 11 21
53 10 9 14 10 26 9 11 9 9 27 19 14 21 9 14 11
13 10 9 11 11 6 11 9 10 6 10 9 19 14 10 11 13
9 10 30 15 7 25 10 9 9 12 11 15 14 46 20 19 11
12 13 10 9 9 14 13 14 9 9 8 9 10 10 9 6 16
11 14 12 10 16 14 6 6 6 12 14 9 9 9 8 7 9
9 9 6 22 16 9 13 11 11 11 9 6 8 11 11 11 9
9 9 6 8 10 14 6 11 8 9 9 18 9 6 10 9 8
9 9 9 9 9 9 12 11 15 11 10 13 9 6 11 11 9