S03036-02_E06
Seqid S03036-02_E06
Sequence >S03036-02_E06.phd
NNNNNNNNNTTTTTNNNNNNNNNNANAGGGCGATTGGCGGCCAAATCGGCCGAATTGAAG
GATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAATTCTC
TACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATTACCAC
TGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGACCACGT
TTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAATGACGT
TATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAATACCAC
TTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAAAAGCC
AACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTTAAGGC
TTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATTGTTGTAATTTACTCA
ACCTTTTCTTTAATATATTTTTAGAAAAATGGTTAAGTACTTTTCCGTCAATACAGCTTC
CACAAAATCCTTTTATTTCAATTAATAAGATATTCTGGTAATTTCTTATTCTAATTCTAG
GAGGCAACACTCCATAACTAAATGTTTATTATAATAATATTAATATAAAAGTTAATATCT
CTTAANGTTACACGCAACTAAACTTTTANTATTATATACTGGTTGCATTGGTATTTTTTA
TCATATATCTTAATATAGGTTTGTTTAAAGGGTCCGTTAATTCGAAGANAGNAGAAGGAA
AAAGAAANAATTAAAAAAAAAAAATAAAAAAACNTCCCAGCCATAAAGGCCACGCGTGAG
AAAATTTGAAAATGTAACGAAAAAAACTTTGACAAAATTN
Quality >S03036-02_E06.phd
7 7 5 5 6 6 6 5 6 12 16 16 12 15 7 5 3
3 7 5 6 5 5 5 9 7 12 9 13 15 9 25 20 23
41 33 15 12 27 16 14 30 12 10 24 42 37 48 28 40 43
41 31 21 34 35 35 18 18 30 41 17 13 49 35 35 31 49
49 42 42 42 50 46 50 51 51 52 50 50 49 49 52 50 29
44 54 50 42 49 50 54 54 54 46 46 49 34 29 43 42 54
50 50 44 42 42 35 21 31 32 42 37 29 32 42 46 46 59
59 44 54 50 54 54 50 49 54 54 47 34 43 45 50 57 54
54 50 50 49 50 42 54 53 51 57 50 49 50 45 45 54 54
57 57 51 46 50 49 50 57 57 53 53 53 53 53 53 45 53
51 57 57 59 57 57 53 53 51 57 57 53 53 57 59 57 52
53 50 57 57 53 53 50 53 53 50 57 50 51 53 51 57 57
53 53 50 54 54 50 50 50 54 54 54 42 44 50 49 50 50
50 60 46 60 60 60 60 59 63 52 50 60 44 39 43 43 44
47 49 60 43 60 50 50 50 60 54 57 58 58 50 63 60 63
63 63 58 60 54 51 54 54 60 54 63 58 58 58 54 63 43
51 58 49 51 52 59 59 57 57 53 53 57 59 57 54 50 57
57 57 54 59 57 57 59 57 53 53 51 57 51 53 57 59 57
53 51 52 51 53 57 59 59 57 57 54 57 57 59 59 57 50
59 54 57 51 49 51 51 53 59 54 43 57 57 57 50 50 50
52 50 59 54 59 59 44 50 43 49 54 59 59 54 51 59 54
57 59 59 57 57 57 59 54 50 44 54 57 57 57 57 49 53
49 53 53 53 51 53 51 54 50 50 50 54 54 49 54 59 54
54 51 50 50 50 42 49 54 57 57 57 57 57 57 54 54 54
54 57 50 57 57 57 51 53 49 49 50 49 46 53 50 53 47
49 51 54 50 57 49 53 46 46 49 54 50 54 54 50 43 52
54 59 57 57 54 57 57 54 49 49 34 53 53 49 57 54 49
46 49 49 49 50 49 50 54 54 50 42 50 50 54 54 50 42
50 35 50 54 54 49 49 42 42 49 50 54 54 52 50 42 49
49 54 50 49 49 49 49 49 49 46 50 54 50 42 50 49 50
39 42 43 50 50 54 54 54 54 54 53 50 39 33 57 42 21
49 42 35 59 54 49 46 49 54 42 54 54 42 54 50 50 54
54 54 54 43 42 54 59 44 59 54 54 54 46 43 54 50 49
42 38 50 42 57 54 54 57 42 59 54 44 54 50 57 42 50
54 54 50 57 54 54 43 59 54 54 50 31 54 42 40 49 30
54 42 43 49 37 46 39 54 50 50 50 50 42 50 50 30 49
50 54 59 42 43 54 42 29 38 44 54 34 38 44 44 54 44
52 29 43 32 43 43 54 42 38 33 30 42 31 50 43 42 43
50 37 30 42 39 44 42 42 42 52 34 50 35 23 27 30 13
28 23 44 59 50 32 33 42 34 54 31 34 59 44 44 31 31
44 39 31 44 29 42 42 43 31 44 59 44 39 27 28 21 59
42 32 27 42 22 44 18 28 29 23 29 17 10 14 19 13 22
38 28 39 36 27 31 39 15 16 9 11 6 8 8 10 21 20
22 23 22 31 36 36 27 35 38 43 39 35 22 28 28 39 25
6 31 11 15 12 12 23 12 11 16 17 27 44 47 32 21 11
10 16 19 35 11 44 13 20 13 27 38 15 14 15 13 13 11
10 18 15 14 24 21 23 23 23 20 23 18 29 35 20 15 27
13 33 22 19 13 23 31 31 44 35 25 34 11 14 13 14 23
20 31 29 52 16 46 33 14 14 20 10 16 6 25 11 7 9
11 10 13 10 10 11 12 14 9 17 18 44 20 20 6 28 12
11 11 11 17 46 20 17 15 14 19 24 30 18 46 14 35 26
29 46 29 15 11 10 7 11 25 23 17 12 13 22 17 11 16
13 14 16 11 16 14 13 11 18 11 11 10 24 11 14 12 14
15 15 14 19 9 10 10 11 22 11 13 15 19 9 10 10 19
9 11 25 17 32 19 41 20 11 11 15 8 12 9 9 27 14
17 16 9 9 7