S03036-02_E07
Seqid S03036-02_E07
Sequence >S03036-02_E07.phd
CNNTACTTTTNNNAANNNNCNANNNATNNAGNGATTGGCGGCGAATCGGCCGAATTGAAG
GANAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATTAAAAATGCAATTCTC
TACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGCTTCTAACATTACCAC
TGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTCCTGTGAGGACCACGT
TTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGTCACCGTAAATGACGT
TATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGCACCAAAGAATACCAC
TTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAAGCCAACTGAAAAGCC
AACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGGTGCCGCTGTTAAGGC
TTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATTGTTGTAATTTACTCA
ACCTTTTCTTTAATATATTTTTAGAAAAATGGTTAAGTACTTTTCCCTCAATACAGCTTC
CACAAAATNCGTNTATGTGANTTAATAAGGTTTTTTGGTTAATTTCTATTTTTTTATAAT
AATATTAATAAAAAAGAAAATANACCCCACCCCCACCCGCAACTAGAGGGGGGAAGGGAA
GAGAAGGTTTGATTGTTTTTTTTTNATTTAATNANAAAAAAAAGGAAGTAAAGGGGCTTG
GGTATGTTTTTAAATTTTAAAAGNAAAGNNCAAAAAAAAACTCCTCCCCCCCCCCCTTNC
GACGGGGGGGAGNGGGGAGANAGGGTATTTTTTTTTTCTTTAAGATANNTTAANNGAGGG
Quality >S03036-02_E07.phd
8 7 7 8 8 8 8 8 14 12 7 7 7 8 8 5 3
3 5 8 6 9 5 7 5 8 8 7 5 8 9 6 15 23
15 16 21 14 8 9 13 10 11 9 13 23 18 21 12 17 20
16 15 15 30 17 13 11 10 12 16 14 6 25 27 22 14 12
17 16 17 21 17 17 21 19 21 21 18 24 23 19 30 26 12
18 32 26 21 24 18 30 24 22 19 19 35 27 25 44 17 23
22 24 20 13 12 12 12 12 11 28 19 18 22 22 35 22 25
31 24 35 31 31 42 39 39 35 44 60 50 47 50 44 50 47
44 42 47 60 42 31 42 42 47 50 44 44 44 44 44 44 60
47 50 47 47 47 47 60 49 54 60 47 44 47 47 47 42 47
54 60 50 50 42 40 35 35 42 47 47 50 47 44 44 47 47
54 50 60 49 43 43 50 63 58 50 63 44 45 51 49 60 58
50 50 47 50 47 40 47 50 47 49 42 33 42 47 60 47 60
50 60 47 60 60 60 60 47 47 40 42 47 34 30 27 20 19
35 42 33 32 47 49 50 50 60 54 50 60 47 60 47 42 47
60 49 50 60 47 36 47 47 60 60 60 54 47 44 50 60 47
50 50 47 44 50 54 60 50 60 50 60 60 54 60 49 47 60
49 47 60 47 50 50 63 57 45 45 50 51 46 49 49 46 50
49 42 43 43 50 54 54 54 50 44 46 54 50 54 54 54 54
54 54 54 49 46 50 50 54 54 50 39 49 49 45 49 50 49
49 46 46 46 49 39 45 50 39 44 49 42 46 29 27 32 30
26 33 26 39 43 42 35 39 42 42 59 59 57 49 45 28 53
49 49 54 50 49 49 42 39 32 36 32 32 32 38 32 43 43
43 49 29 44 49 54 54 50 50 49 49 57 57 54 42 47 47
47 60 49 49 47 44 47 60 54 54 47 47 35 50 47 49 47
42 47 47 60 60 60 60 60 49 47 50 47 47 49 54 47 50
47 44 60 60 42 42 43 39 44 60 47 42 47 47 60 47 50
54 50 47 47 49 47 40 43 33 40 42 44 42 42 39 42 40
42 33 44 44 42 35 37 42 25 27 35 39 22 27 38 29 22
42 42 28 54 44 35 42 47 50 44 50 60 47 37 60 57 47
46 42 46 60 44 44 39 34 44 46 57 52 46 23 47 47 13
34 31 16 29 57 19 47 34 60 34 34 47 31 35 20 30 29
42 29 42 46 44 35 35 10 27 52 46 57 35 46 52 47 57
52 42 46 47 52 47 46 46 26 46 41 15 35 32 32 17 29
46 35 25 27 28 31 46 15 9 8 13 13 17 20 34 35 12
16 47 23 47 42 28 11 23 16 13 16 19 10 6 10 9 18
7 16 27 10 10 13 11 11 7 11 12 11 11 10 10 11 13
9 8 9 10 20 11 21 21 31 23 16 18 9 26 27 31 11
22 11 15 16 32 31 18 28 24 20 28 35 20 20 10 14 17
18 15 11 23 53 11 9 23 32 32 40 22 14 11 10 14 20
14 27 7 9 11 19 16 15 11 13 14 15 13 11 12 26 15
22 11 34 13 14 13 18 14 10 8 10 14 15 11 9 11 10
9 9 13 13 14 10 10 11 13 15 11 11 10 10 9 10 12
19 14 24 9 27 13 19 32 23 46 13 10 9 7 9 11 15
15 11 25 20 6 9 6 15 46 28 25 25 32 32 14 14 16
10 11 15 11 15 11 16 13 11 17 32 18 12 10 8 15 13
14 11 10 9 12 16 18 20 14 10 9 14 11 9 10 13 9
23 10 20 9 7 8 10 11 9 6 6 9 10 18 18 16 10
22 17 17 10 9 11 11 10 13 11 17 18 10 14 13 19 27
20 13 16 16 18 7 9 11 19 8 14 18 15 14 13 11 10
10 9 6 12 11 15 11 12 15 9 6 8 9 9 10 11 13
20 16 15 15 22 21 15 18 14 11 11 10 28 20 19 8 9
9 8 9 6 6 8 8 11 23 6 6 8 10 11 13 12