S03036-02_E11
Seqid S03036-02_E11
Sequence >S03036-02_E11.phd
NNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNGGGCGATTGGCGGCCAAATCGGCCGAATT
CCCATGGGGATCCGATATCAAGCTTGGGCCCGGTACCGGCCATAAGGGCCAGCTTGAGTA
TTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAA
ATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCT
GGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCC
AGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCG
GTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTC
GGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAG
GGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAA
AGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAANT
CNACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCC
CCTGGAAGCTCCATCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCC
GCCATTCTCCCTCCCCGCAAGCGTGGCGCTTTCGNATAANTCAAGTTGTTAGGTATTTCA
TTTTGGTTTTAGGTCATTCACTCCAAAGGGGGGTGCGTGCACGAAACCCCCCGTTTTACC
NGAAAGAGAGAGGCAAAACCCATCACTCNCCCCTTGAGGGAAGGCGAGAGAAGAGGGGGG
TTTAGTCTAAGATTTTTTGTCTTTAGTAAAAGAAAAAAGG
Quality >S03036-02_E11.phd
4 3 3 2 3 3 2 3 5 6 7 6 7 5 4 5 7
7 5 5 5 5 7 5 8 5 5 5 6 3 5 12 22 22
12 26 31 15 35 31 14 14 42 31 20 19 14 15 27 41 41
48 28 33 40 41 34 19 37 36 31 21 21 16 36 50 49 41
43 16 17 34 37 34 44 30 41 40 30 32 36 42 40 52 46
50 43 26 42 49 47 49 49 42 40 41 54 42 42 43 39 30
54 50 54 43 54 42 50 50 43 42 35 43 54 54 41 50 43
54 42 54 54 44 46 43 44 54 59 59 54 50 54 50 50 50
50 54 54 54 54 59 49 49 54 57 44 50 54 50 59 59 59
54 49 54 57 54 50 49 46 51 53 51 51 53 51 50 49 50
54 54 54 57 57 57 54 54 52 49 49 51 51 57 57 51 49
57 59 57 51 47 53 53 49 57 52 46 46 57 57 50 50 57
57 57 63 63 63 52 63 60 52 60 63 51 60 51 50 60 58
54 51 60 59 59 54 60 60 54 54 57 54 50 47 47 50 47
43 44 49 63 43 63 60 51 47 47 50 49 60 49 60 54 50
60 63 58 60 58 57 54 59 50 51 49 60 54 54 58 58 50
57 58 63 63 58 63 63 63 58 50 52 50 63 58 60 52 63
63 59 63 63 63 54 63 63 51 54 54 50 51 51 50 51 53
53 53 53 49 39 51 51 53 57 54 57 51 53 49 53 44 52
53 53 53 54 54 50 49 50 50 50 57 51 49 50 54 49 44
44 44 39 51 49 49 57 54 54 46 38 38 44 45 33 45 33
44 44 49 53 42 49 49 51 44 52 54 54 50 49 53 57 57
50 50 50 57 50 53 50 49 49 50 50 49 50 42 43 44 50
38 43 49 54 50 46 49 50 52 44 54 54 57 54 54 50 49
54 59 54 49 45 53 50 54 54 54 49 49 50 50 42 51 51
54 44 42 46 50 50 43 49 49 54 54 54 50 49 50 54 50
49 49 49 50 54 54 46 50 51 46 50 42 52 50 42 54 54
43 49 50 46 42 42 42 49 46 41 49 33 46 32 33 40 39
39 43 29 26 25 23 46 38 21 42 50 42 43 34 38 29 50
39 43 46 33 35 54 33 42 50 50 39 50 42 25 50 31 54
46 40 33 38 27 39 32 27 33 28 35 42 42 37 50 18 46
33 25 49 42 37 35 49 31 26 35 54 49 54 50 33 54 24
43 49 42 42 34 54 54 33 42 50 54 44 59 54 52 59 42
42 28 39 25 43 35 29 42 19 54 39 49 37 33 50 46 34
39 35 42 42 37 17 12 38 22 15 12 16 12 35 23 30 37
42 37 9 7 8 10 6 18 36 12 22 16 17 16 22 21 36
14 10 15 39 29 44 28 44 44 15 35 29 18 11 13 13 36
27 35 22 20 31 39 21 22 27 39 31 23 29 25 19 31 26
11 22 12 15 9 24 18 22 27 17 16 18 22 35 39 27 21
21 25 31 44 12 16 14 10 10 8 12 35 35 25 47 35 24
33 33 35 28 25 33 28 42 23 33 19 19 25 35 24 27 27
44 33 25 44 44 24 44 60 35 20 34 24 27 46 14 15 13
16 15 27 20 11 20 14 17 25 9 15 19 19 19 27 35 32
9 9 18 14 14 13 16 16 18 9 12 11 19 29 23 13 16
25 20 31 16 10 9 7 11 11 22 9 6 12 13 14 12 14
13 20 11 16 15 28 14 26 46 14 29 14 23 16 16 12 46
27 10 10 10 16 10 11 10 33 18 12 14 12 11 12 11 14
10 9 16 20 36 28 32 10 10 18 14 18 22 11 13 16 10
14 14 11 15 12 18 14 34 32 14 19 22 23 40 27 19 20
15 14 29 11 22 10 11 7 11 20 35 10 14 24 14 11 11
14 11 14 11 10 14 24 11 11 10 11 15 11 12 15 32 14
11 7 18 15 15 16 11 13 11 11 28 16 15 11 13 15 10
11 18 12 34 11 27 16 13 14 13 18 14 14 10 15 11 22
16 15 15 9 14 11 14 13 12 8 9 14 13 13 16 15 8
9 11 10 14 15 14 10 9 9 27 13 18 11 11 10 23 28
13 17 20 18 14