S03036-02_E12
Seqid S03036-02_E12
Sequence >S03036-02_E12.phd
NNNNNNNNNTNNNNNGNNNNNCNNNNNGGGCGATTGGCGGCCAAATCGGCCGAATTGATA
GAATAAAAAACCAAGGATAACAAACATCTTCTTTCGTTCGCTTCAAAATAACTACAAATT
AAAAATGCAATTCTCTACCGTCGCTTCTATCGCTGCTATTGCCGCTGTTGCCTCCGCCGC
TTCTAACATTACCACTGCTACTGTCACAGAAGAATCTACCACTTTGGTCACTATCACTTC
CTGTGAGGACCACGTTTGTTCTGAAACAGTTTCCCCAGCTTTGGTTTCCACTGCTACCGT
CACCGTAAATGACGTTATCACTCAATACACCACCTGGTGTCCATTGCCAACCACTGAAGC
ACCAAAGAATACCACTTCTCCAGCTCCAACTGAAAAGCCAACCGAAAAGCCAACTGAAAA
GCCAACTGAAAAGCCAACCCAACAAGGTTCTAGCACTCAAACTGTTACCTCCTACACTGG
TGCCGCTGTTAAGGCTTTGCCAGCTGCCGGTGCTTTGTTGGCTGGTGCTGCCGCTTTATT
GTTGTAATTTACTCAACCTTTTCTTTAATATATTTTTAGAAAAATGGTTAAGTACTTTTC
CGTCAATACAGCTTCCACAAAATCCTTTTATTTCAATTAATAAGATATTCTGGTAATTTC
TTATTCTAATTCTAGGNNNNCAACACTCCATAACTAAATGTTTATTATAATAATATTAAT
ATAAAGTTAANATCTCTTAGGNNACACGCAANTANCNTTTNNNNATNTATACTGGTNGCA
TTGNNTNNNTATCATATATCTNAAAAATAGGNAGTTTTAAGNNNTCGTTAANAAAANAGG
AAGGNNNAAAAATAAAATANGGTTNAAAAAAACNNGTNCGGGGAAAAAGGAGAGCCNGAG
AAATCTAAAAGGANNCTAAANAGTT
Quality >S03036-02_E12.phd
5 3 2 6 7 5 5 4 6 8 6 5 5 5 3 15 5
5 3 7 5 9 6 5 3 3 5 14 25 19 9 26 27 19
40 40 14 12 36 21 16 25 19 16 25 35 36 47 26 41 46
43 32 18 25 40 38 14 23 30 30 29 29 19 37 35 43 42
42 42 41 31 31 46 46 49 20 16 47 49 46 36 36 46 36
30 31 37 46 46 52 52 52 52 50 28 31 29 35 30 38 49
54 46 38 43 54 59 59 52 54 54 52 54 50 43 54 49 49
43 54 49 50 59 59 46 43 54 50 46 51 53 50 54 54 51
51 51 49 54 54 50 46 50 59 51 45 42 54 59 54 50 50
50 54 57 42 50 49 46 49 50 52 50 45 52 57 54 54 54
47 49 50 57 53 54 54 54 54 52 54 57 57 57 54 59 59
57 53 53 57 57 51 57 57 53 53 53 45 57 53 53 57 57
57 57 51 47 44 57 54 50 57 50 50 57 57 57 57 57 52
52 57 57 50 52 50 50 57 54 57 50 50 49 50 42 44 38
29 38 43 46 54 59 52 50 50 50 44 32 50 54 54 57 53
51 51 57 50 51 51 54 51 57 51 57 54 50 59 59 59 57
57 57 59 57 57 57 57 59 57 57 57 51 57 57 57 57 54
59 57 57 59 57 57 59 54 57 59 59 59 59 57 54 50 54
54 54 50 57 59 57 54 50 54 59 59 54 57 46 51 59 57
49 53 52 59 59 59 59 57 59 59 59 59 57 53 54 59 59
59 57 59 59 59 59 51 47 43 57 59 54 54 54 54 57 50
50 54 59 59 50 54 59 59 54 50 57 57 52 57 43 53 49
57 57 53 53 51 54 54 42 59 59 50 50 50 54 59 59 59
57 57 59 59 57 59 54 57 50 57 59 59 54 53 57 59 59
54 52 57 54 59 54 57 53 53 57 57 53 54 50 50 54 57
50 51 57 57 57 57 57 59 51 50 54 54 52 50 50 50 54
54 54 53 46 53 54 53 49 53 49 57 54 54 50 57 54 46
49 49 49 49 49 54 54 54 42 49 54 54 49 49 49 49 35
54 54 52 54 59 59 54 54 47 47 57 59 54 37 54 54 36
42 40 59 54 57 46 37 49 43 49 49 57 59 46 51 49 57
54 49 50 49 53 51 59 59 54 59 50 38 59 59 54 30 42
47 49 42 49 49 42 50 49 51 46 46 32 49 50 35 54 54
38 46 49 46 49 49 46 54 49 42 35 49 46 49 46 51 46
46 35 46 49 45 35 50 49 54 54 54 37 49 49 49 49 46
37 45 34 21 43 42 29 49 35 18 49 42 42 29 43 46 35
35 49 46 45 28 45 35 35 35 18 20 37 41 54 30 49 49
49 49 30 29 34 30 13 8 12 18 40 32 31 41 54 49 46
49 32 35 34 32 23 26 28 40 19 22 24 28 45 32 52 16
38 21 41 36 35 43 49 28 33 30 27 43 46 43 37 30 38
25 37 37 35 29 23 25 47 37 29 31 24 34 6 5 4 7
17 18 28 19 17 25 34 14 16 28 37 27 40 37 35 32 20
21 27 46 22 33 29 26 19 42 27 15 25 35 22 42 42 24
32 50 42 32 33 20 24 11 33 47 49 26 23 22 18 15 7
8 8 8 15 26 26 26 30 15 11 7 6 11 12 17 20 9
13 12 21 7 11 9 7 8 6 16 16 9 5 5 6 7 9
27 7 9 12 28 31 29 22 27 21 9 6 14 14 10 9 9
8 6 7 12 7 7 7 8 11 17 11 11 9 14 13 13 15
10 11 7 10 10 9 12 18 9 18 11 9 7 9 14 11 21
35 21 21 27 9 6 7 7 9 12 9 16 28 11 8 6 16
11 14 19 6 23 10 14 11 20 17 10 5 6 7 22 12 12
20 12 11 12 29 16 13 9 13 6 19 10 10 9 6 26 13
15 20 14 20 14 9 7 6 24 17 7 16 10 11 16 8 9
13 9 11 16 9 11 11 8 13 11 13 9 7 12 13 12 9
11 9 22 11 14 18 11 11 11 15 18 10 6 6 10 9 22
10 9 6 10 9 11 12