S03036-02_E13
Seqid S03036-02_E13
Sequence >S03036-02_E13.phd
TNNNNNTTTTNNGGNNCNANNNNNAGGGCGATTGGCGGCCNNTCGGCCGAATTGCTACAC
ACATATATATATAGCCAATTTTATATATACGTTCCTATATATGACCCAATACCGCACTTA
TTTATTCTTTAAGATCTTTATAACCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAGTACCGGCCATAAGGGCCAGCTTGAGTATTCTATAGTGTCACCTAAAT
AGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATT
CCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGC
TAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGC
CAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCT
TCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCA
GCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGAATAACGCAGGAAANACN
ATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAAGCCGCGTTGCTGGCGTTT
TTTCCAAAGGCTCCCCCCCCCTGACNAGCTTCNCAAAAAACGACGCTCAAATCAGAGGTT
GGCGAAACCCCCAAGGACATAGAAGATACAGGGGGTTCCCCCCGGGGGAGCTCCATTTAT
GCNTTTTCATGTTCCAACCAGGCCGCTTACCGGANACATGTGCGGCTTACGCCCTGAGGG
AGCGTGGAGTTTCCCACAACCCAACCTCAAGCCTTCTCGAGTGTGGTTGNGTGGGGGTAG
GAAGTNNTATTNGNGGCCGAAAAGCCTCAC
Quality >S03036-02_E13.phd
9 6 5 5 4 7 8 8 13 14 5 6 14 8 5 3 9
7 9 5 5 3 5 7 11 8 14 10 8 10 12 16 27 23
8 10 36 25 18 11 7 5 30 41 38 35 46 37 44 42 15
28 34 26 18 24 27 35 28 30 32 37 33 47 54 54 43 54
54 42 54 59 42 42 35 30 34 44 42 46 36 21 35 42 47
50 50 54 54 47 39 60 40 47 57 47 52 52 47 44 47 35
40 35 35 40 33 42 44 42 60 52 60 57 46 57 42 60 35
40 46 57 52 47 53 57 60 58 63 52 60 48 57 58 52 57
63 63 53 63 57 58 63 63 60 58 58 52 57 60 57 48 57
60 60 60 60 60 60 60 60 60 60 60 60 60 57 57 60 60
60 60 60 60 52 52 47 46 47 57 60 60 60 57 57 57 60
60 60 60 47 19 46 47 42 52 47 48 57 60 47 37 37 41
47 46 60 42 44 47 41 41 34 35 34 42 32 46 46 46 41
39 41 41 41 37 39 26 22 35 26 41 46 47 41 32 46 57
47 41 41 41 42 28 23 40 42 32 37 37 42 42 46 47 41
44 57 60 46 44 35 35 39 47 47 41 32 35 43 40 52 47
34 40 22 41 30 41 46 57 57 47 42 40 35 52 60 47 57
35 35 41 39 39 41 41 52 60 60 46 60 46 35 42 39 40
47 43 40 34 37 37 39 30 40 39 60 52 42 47 47 57 46
60 47 42 46 60 60 29 22 32 34 52 60 42 42 47 36 27
60 57 40 35 24 20 35 60 47 47 42 42 36 20 17 21 33
35 35 47 47 60 54 47 60 47 47 40 43 49 50 50 47 47
60 47 47 42 47 60 54 50 42 40 35 42 44 42 40 44 60
43 38 36 32 47 54 50 54 44 38 50 43 46 46 43 39 42
49 49 36 43 42 49 38 37 18 17 32 43 35 27 26 30 36
50 39 35 43 49 49 42 27 34 46 50 43 54 59 44 44 44
46 54 42 39 38 35 38 46 53 50 44 44 32 44 34 51 44
54 50 35 50 46 43 32 37 35 29 35 35 40 35 39 33 30
42 35 35 49 50 42 39 37 32 43 42 42 33 33 30 39 23
35 25 37 19 24 31 31 18 43 29 26 33 42 34 37 20 26
33 30 44 42 29 29 33 38 42 22 38 42 34 43 50 34 31
33 23 19 32 25 16 28 32 19 32 26 20 20 27 28 35 22
30 30 41 30 28 38 42 41 42 13 32 46 30 32 35 26 26
28 26 35 25 23 19 35 32 32 21 30 35 14 35 38 13 32
27 27 54 49 8 54 15 59 46 27 17 25 32 12 21 32 35
20 6 9 9 7 15 19 17 16 14 18 9 17 9 35 30 30
24 27 18 12 12 14 15 27 32 32 25 14 20 10 15 21 25
26 16 43 18 14 11 17 23 32 32 30 18 12 19 10 15 19
21 16 28 31 14 11 10 16 11 15 11 18 29 30 19 28 29
22 25 24 9 9 10 14 25 24 28 17 12 18 24 35 37 24
21 15 27 33 13 7 11 10 16 12 17 12 6 15 11 21 29
30 21 13 11 19 22 21 11 28 34 23 21 16 17 21 16 12
11 22 14 22 14 11 27 20 16 11 29 14 15 18 22 16 10
11 15 11 13 15 11 10 10 11 10 11 11 10 12 12 10 10
12 22 28 22 36 14 19 11 11 11 11 18 11 17 9 10 9
16 17 11 21 11 11 18 11 17 15 13 16 11 8 10 13 9
7 9 13 14 11 17 14 16 23 15 17 14 14 11 16 19 17
14 9 13 13 11 14 15 20 15 14 20 20 16 13 13 7 15
19 14 14 15 12 12 14 12 13 13 11 11 10 10 10 19 18
12 16 12 11 15 12 15 11 11 10 22 16 31 29 29 15 11
15 27 11 11 14 17 19 13 11 11 18 14 17 16 11 14 10
9 13 13 14 11 9 14 11 13 11 15 17 13 28 17 17 18
16 14 10 9 10 7 12 10 14 19 17 20 21 11 14 25 17
15 13 14 13 7 7 11 9 10 9 6 22 6 19 23 20 14
11 29 32 30 34 10 16 9 9 11 10 9